Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method and application of increasing algae total phosphorus and polyphosphoric acid content through ptc gene manipulation

A polyphosphoric acid and phosphorus content technology, applied in the direction of microorganism-based methods, chemical instruments and methods, biochemical equipment and methods, etc., can solve the problems of low cost and high technical requirements

Active Publication Date: 2020-11-20
INST OF AGRI RESOURCES & REGIONAL PLANNING CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the methods of phosphorus removal mainly include chemical method, precipitation method, biological method, etc. The biological method is simple and low in cost, but has high technical requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method and application of increasing algae total phosphorus and polyphosphoric acid content through ptc gene manipulation
  • A method and application of increasing algae total phosphorus and polyphosphoric acid content through ptc gene manipulation
  • A method and application of increasing algae total phosphorus and polyphosphoric acid content through ptc gene manipulation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Embodiment 1, the preparation of recombinant Chlamydomonas

[0049] Both Chlamydomonas CC-4533 and Chlamydomonas mutants were purchased from https: / / www.chlamylibrary.org / . The Chlamydomonas mutant is Mutant strain: LMJ.RY0402.181899 in https: / / www.chlamylibrary.org / , and it is named Chlamydomonas mutant ptc1.

[0050] Extract the genomic DNA of Chlamydomonas chinensis, and use F1 / R1 primer pair or F1 / R2 primer pair to carry out PCR amplification (primer design principles of F1, R1 and R2 see figure 1 Primer F1: GGGCCGTACACCTAACTTGA; Primer R1: ACCTCTACATTGGCCAGCAC; Primer R2: GACGTTACAGCACACCCTTG; the target sequence of F1 and R1 is about 1410bp, and the target sequence of F1 and R2 is about 800bp), the electropherogram of the PCR amplification product is shown in figure 1 b. The tested Chlamydomonas were: Chlamydomonas CC-4533 and Chlamydomonas mutant ptc1.

[0051] Whole genome sequencing of Chlamydomonas was performed. The tested Chlamydomonas were: Chlamydomo...

Embodiment 2

[0053] The detection of polyphosphoric acid content in embodiment 2, Chlamydomonas

[0054] The tested Chlamydomonas were Chlamydomonas CC-4533, Chlamydomonas mutant ptc1 and Chlamydomonas JP13.

[0055] 1. Prepare the solution

[0056] Ammonium molybdate solution: containing 28mM ammonium molybdate and 2.1M H 2 SO 4 , and the balance is water.

[0057] Malachite green solution: containing 0.76mM malachite green and 0.35g / 100ml polyvinyl alcohol, and the balance is water.

[0058] Neutral red mother liquor: contains 0.1g / 100ml neutral red, and the balance is water.

[0059] Neutral red solution: 60 μl neutral red mother solution and 940 μl Tris-HCl buffer solution (pH7.5, 1M), mix well.

[0060] NaI solution: containing 6M NaI, the balance is water, adjust the pH to 7.0.

[0061] Wash buffer: containing 50% (volume ratio) ethanol, 1mM EDTA, 100mM NaCl, and the balance is Tris-HCl buffer solution (pH7.5, 10mM).

[0062] 2. Make a standard curve

[0063] use KH 2 PO 4 ...

Embodiment 3

[0088] The detection of total phosphorus content in embodiment 3, Chlamydomonas

[0089] The tested Chlamydomonas were Chlamydomonas CC-4533, Chlamydomonas mutant ptc1 and Chlamydomonas JP13.

[0090] Cultivate Chlamydomonas. Cultivation method: Inoculate Chlamydomonas to TAP medium, 24°C, 12h light (light intensity 150μmol m -2 the s -1 ) / 12h dark, 150rpm shaking culture, until the concentration of Chlamydomonas in the culture system for the test is 5×10 7 cells / ml.

[0091] Take two equal volumes of the culture system that have completed the above steps, one is dried to constant weight (weighed, that is, dry weight), and the other is tested for total phosphorus content.

[0092] For the method of detecting total phosphorus content, see the reference: Bajhaiya AK, Dean AP, Zeef LA, Webster RE, Pittman JK (2016) PSR1Is a Global Transcriptional Regulator of PhosphorusDeficiency Responses and Carbon Storage Metabolism in Chlamydomonasreinhardtii. Plant Physiol 170:1216-12

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing algal total phosphorus and polyphosphoric acid content through PTC gene operation and application. Provided protein is named as ptc1 protein and shown as a sequence 1 in a sequence table. Nucleic acid molecule coding the protein also belongs to the protection range of the invention. The invention further discloses recombinant microalgae which is obtained by inhibiting expression of gene coding the protein in starting microalgae. The invention further discloses application of the recombinant microalgae in water phosphorus removal or in fertilizerpreparation. The inventor finds a protein related to polyphosphoric acid balance in chlamydomonas, polyphosphoric acid accumulation and total phosphorus content increase are caused after gene coding the protein in chlamydomonas is silenced, and alkaline phosphatase can be efficiently secreted, so that effect of chlamydomonas on purifying phosphorus in water can be promoted, and high-phosphorus chlamydomonas is a great microalgae fertilizer raw material.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method and application for increasing the content of total phosphorus and polyphosphoric acid in algae through PTC gene manipulation. Background technique [0002] Eutrophication of water bodies has become an increasingly serious environmental problem worldwide. In recent years, a large amount of nitrogen, phosphorus, potassium and other elements have been discharged into various water bodies at a speed far exceeding the self-purification speed of the water body, the ecological balance of the water body has been broken, and red tides and other problems have become serious. Phosphorus is a key element for water eutrophication, and removing phosphorus from water is the key to water restoration. At present, the methods of phosphorus removal mainly include chemical method, precipitation method, biological method, etc. The biological method is simple and low in cost, but ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/13C12N15/79C12R1/89
CPCC07K14/405C07K2319/21C07K2319/22C07K2319/40C07K2319/41C07K2319/42C12N15/79
Inventor 易可可王龙朱毅勇徐国超
Owner INST OF AGRI RESOURCES & REGIONAL PLANNING CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com