Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sorghum transcription factor SbSBP5 gene and recombinant vector and expression method thereof

A technology of transcription factors and recombinant vectors, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems that have not yet been seen in the research reports of SBP transcription factors

Inactive Publication Date: 2019-07-05
GUIZHOU UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, SBP transcription factors have been found in Arabidopsis thaliana, alfalfa, corn, Chinese cabbage, tomato, rice, etc., but so far, there has been no research report on SBP transcription factors in sorghum at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sorghum transcription factor SbSBP5 gene and recombinant vector and expression method thereof
  • Sorghum transcription factor SbSBP5 gene and recombinant vector and expression method thereof
  • Sorghum transcription factor SbSBP5 gene and recombinant vector and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Acquisition and Analysis of Sorghum Transcription Factor SbSBP5 Gene

[0034] According to the protein sequence of the reported rice SBP gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene SbSBP5 (gene number is Sb08g005080, and its nucleotide sequence is shown in SEQ ID NO.1). Search the NCBI database with the SbSBP5 protein (its amino acid sequence is shown in SEQ ID NO.2), download the SBP genes in other species, and use the MEGA 7.0 software to construct a no root phylogenetic tree, by figure 1 It can be seen that SbSBP5 and millet (Setaria italica) SBP are clustered together and have the closest relationship. It can be known that SbSBP5 gene is a sorghum transcription factor.

Embodiment 2

[0035] Example 2: Construction and Identification of Sorghum Transcription Factor SbSBP5 Gene Recombination Vector

[0036] 1. Extract sorghum RNA and reverse transcribe cDNA

[0037] The sorghum BTx623 material was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was obtained by reverse transcription with a reverse transcription kit (Promega).

[0038] 2. Using cDNA as a template to amplify the SbSBP5 gene;

[0039] Primers were designed to amplify the SbSBP5 gene using cDNA as a template.

[0040] Primers are as follows:

[0041] Upstream primer: SbSBP5-F: GC GGATCC ATGGAGTCCGGTGGCG is underlined as the BamHI restriction site;

[0042] Downstream primer: SbSBP5-R:CG GAATTC The underline of CTAGAGTGACCAGTCCATTGTGT is the EcoRI restriction site;

[0043] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.

[0044] The PCR amplification system...

Embodiment 3

[0049] Example 3: Induced expression of SbSBP5 protein

[0050] 1. Obtain the recombinant prokaryotic expression strain of SbSBP5

[0051] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - The SbSBP5 recombinant expression vector was extracted, and the recombinant expression vector plasmid was transformed into Escherichia coli expression strains BL21(DE3), JM109(DE3), BL21(DE3)pLysS, Tuner(DE3), Rosetta(DE3), and the expression of SbSBP5 protein was detected.

[0052] 2. Cultivate the activated strain overnight

[0053] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL In mL kanamycin+50ug / mL chloramphenicol liquid medium, cultivate the activate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sorghum transcription factor SbSBP5 gene, and the nucleotide sequence of the sorghum transcription factor SbSBP5 gene is shown as SEQ ID NO. 1. The invention also discloses aprotein encoded by the sorghum transcription factor SbSBP5 gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2. The invention further discloses a recombinant vector containing the sorghum transcription factor SbSBP5 gene and an expression method. According to the invention, a sorghum homologous gene SbSBP5 is obtained from a sorghum genome database through the protein sequence of a rice SBP gene, the full length of the gene is 1227bp, a prokaryotic expression vector is constructed according to the gene, a protein purification system is used for purifying the prokaryoticexpression vector, the result lays a foundation for further researching a protein crystal structure and biological characteristics, and a basis is provided for improving the disease resistance of sorghum through a gene editing method.

Description

technical field [0001] The invention relates to a sorghum transcription factor SbSBP5 gene, a recombinant vector and an expression method thereof, and belongs to the field of biotechnology. Background technique [0002] Sorghum (Sorghum bicolor (L.) Moench), also known as water millet and chestnut, is an important cereal crop with strong resistance to adversity. It is an important raw material, and it is also a kind of animal husbandry crop that has been widely used in recent years. Sorghum has a long history of cultivation in my country, and it was not cultivated on a large scale before the founding of the People's Republic of China. It was not until the 1970s, with the development of economy and society, that my country gradually paid attention to and cultivated sorghum on a large scale. Sorghum is a short-day C4 plant. Compared with other energy crops, sorghum has more obvious photosynthetic efficiency and higher yield advantages, so it is known as a "high-energy crop". ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/70C12N15/66
CPCC07K14/415C12N15/70C12N15/66
Inventor 谢鑫蒋君梅任明见李向阳孙涛
Owner GUIZHOU UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More