Sorghum transcription factor SbSBP5 gene and recombinant vector and expression method thereof
A technology of transcription factors and recombinant vectors, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve the problems that have not yet been seen in the research reports of SBP transcription factors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1: Acquisition and Analysis of Sorghum Transcription Factor SbSBP5 Gene
[0034] According to the protein sequence of the reported rice SBP gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene SbSBP5 (gene number is Sb08g005080, and its nucleotide sequence is shown in SEQ ID NO.1). Search the NCBI database with the SbSBP5 protein (its amino acid sequence is shown in SEQ ID NO.2), download the SBP genes in other species, and use the MEGA 7.0 software to construct a no root phylogenetic tree, by figure 1 It can be seen that SbSBP5 and millet (Setaria italica) SBP are clustered together and have the closest relationship. It can be known that SbSBP5 gene is a sorghum transcription factor.
Embodiment 2
[0035] Example 2: Construction and Identification of Sorghum Transcription Factor SbSBP5 Gene Recombination Vector
[0036] 1. Extract sorghum RNA and reverse transcribe cDNA
[0037] The sorghum BTx623 material was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was obtained by reverse transcription with a reverse transcription kit (Promega).
[0038] 2. Using cDNA as a template to amplify the SbSBP5 gene;
[0039] Primers were designed to amplify the SbSBP5 gene using cDNA as a template.
[0040] Primers are as follows:
[0041] Upstream primer: SbSBP5-F: GC GGATCC ATGGAGTCCGGTGGCG is underlined as the BamHI restriction site;
[0042] Downstream primer: SbSBP5-R:CG GAATTC The underline of CTAGAGTGACCAGTCCATTGTGT is the EcoRI restriction site;
[0043] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.
[0044] The PCR amplification system...
Embodiment 3
[0049] Example 3: Induced expression of SbSBP5 protein
[0050] 1. Obtain the recombinant prokaryotic expression strain of SbSBP5
[0051] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - The SbSBP5 recombinant expression vector was extracted, and the recombinant expression vector plasmid was transformed into Escherichia coli expression strains BL21(DE3), JM109(DE3), BL21(DE3)pLysS, Tuner(DE3), Rosetta(DE3), and the expression of SbSBP5 protein was detected.
[0052] 2. Cultivate the activated strain overnight
[0053] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL In mL kanamycin+50ug / mL chloramphenicol liquid medium, cultivate the activate...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


