Method for genetic modification of intestinal protobacteria based on microencapsulation treatment

A genetic modification and microencapsulation technology, applied in microorganism-based methods, transforming growth factors, chemical instruments and methods, etc., can solve the problems of not fully meeting research needs, high price of germ-free mice, and long transplantation period, etc. To achieve the effect of efficient and convenient colonization, improved biological compliance, and low cost

Inactive Publication Date: 2019-07-26
TIANJIN UNIV
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the price of germ-free mice is high, and due to certain immunodeficiency after gene knockout, it cannot fully meet the research needs
Bacteria transplantation has problems such as long transplantation period and low colonization efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for genetic modification of intestinal protobacteria based on microencapsulation treatment
  • Method for genetic modification of intestinal protobacteria based on microencapsulation treatment
  • Method for genetic modification of intestinal protobacteria based on microencapsulation treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1) Screening of native Escherichia coli in the intestine of C57BL / 6 mice

[0040] ①Take fresh intestinal tissue from C57BL / 6 mice in a sterile EP tube;

[0041] ② Wash the intestinal contents with pre-cooled sterile PBS;

[0042] ③After cutting the intestinal wall, cut the intestinal wall with a sterile glass slide, mix the intestinal wall with sterile pre-cooled PBS at a mass volume ratio of m / v=1:10, and vortex for 15 minutes;

[0043] ④ Centrifuge the mixture at 4°C, 2000rpm for 5min, discard the precipitate, centrifuge the supernatant at 4°C, 12000rpm for 20min, discard the supernatant, and keep the precipitate;

[0044] ⑤ After resuspending the pellet with 100 μL PBS, take 10 μL and spread it on a solid LB plate for blue-white plate screening, and culture overnight at 37°C;

[0045] ⑥The next day, according to the growth of the plate, pick blue colonies for colony PCR (two pairs of primers for colony PCR are LaZ-YZ-F: AACGGGGGTACTGACGAAAC; LaZ-YZ-R: GAACCATCCGCTG...

Embodiment 2

[0064] 1) Screening of native Escherichia coli in the intestine of C57BL / 6 mice

[0065] ①Take fresh intestinal tissue from C57BL / 6 mice in a sterile EP tube;

[0066] ② Wash the intestinal contents with pre-cooled sterile PBS;

[0067] ③After cutting the intestinal wall, cut the intestinal wall with a sterile glass slide, mix the intestinal wall with sterile pre-cooled PBS at a mass volume ratio of m / v=1:10, and vortex for 15 minutes;

[0068] ④ Centrifuge the mixture at 4°C, 2000rpm for 5min, discard the precipitate, centrifuge the supernatant at 4°C, 12000rpm for 20min, discard the supernatant, and keep the precipitate;

[0069] ⑤ After resuspending the pellet with 100 μL PBS, take 10 μL and spread it on a solid LB plate for blue-white plate screening, and culture overnight at 37°C;

[0070] ⑥The next day, according to the growth of the plate, pick blue colonies for colony PCR (the two pairs of primers for colony PCR are LaZ-YZ-F: AACGGGGGTACTGACGAAAC; LaZ-YZ-R: GAACCATCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for genetic modification of intestinal protobacteria based on microencapsulation treatment. The method mainly includes utilizing the method of synthetic biology to genetically transform the selected intestinal primary escherichia coli and then perform microencapsulation treatment. The biosafety synthetic biology technology is combined with the non-invasive optogenetic technique for the treatment of intestinal diseases, and the method has many advantages compared with the traditional methods for treating the intestinal diseases. The intestinal primary escherichia coli are subjected to genetic modification, and the intestinal colonization compliance of the microencapsulated protobacteria is improved in the later stage. A single functional bioactive molecule,that is, a transforming growth factor (TGF-beta1) secreted by the primary escherichia coli is taken as an example to study the application in treatment of inflammatory bowel disease (IBD). The methodprovides a new idea for studying the interaction between enteric microorganisms and the body.

Description

technical field [0001] The invention relates to the field of microorganisms and clinical treatment, in particular to a method for genetic modification of intestinal protobacteria based on microencapsulation treatment. Background technique [0002] As the largest organ in an organism, the intestine plays an important role in digestion and absorption, immune regulation and other aspects. In addition to epithelial cells and immune cells that perform digestion, absorption, and immune regulation functions, the intestinal tract also contains many microorganisms. More than 99.9% of the microorganisms are bacteria, which are collectively known as the gut flora. [0003] Gut flora, as a "symbiont" in the gut of organisms, participates in the regulation of many important life processes and diseases. Most of the existing methods for studying the relationship between intestinal microbes and the body are to use germ-free mice or extensive flora transplantation, combined with microbiome...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K35/74A61K9/50A61P1/00A61P29/00C12N1/21C12N15/70C12R1/19
CPCA61K9/5031A61K35/74A61P1/00A61P29/00C07K14/495C12N15/70
Inventor王汉杰崔梅慧常津李树斌孙韬潘惠卓
OwnerTIANJIN UNIV