Unlock instant, AI-driven research and patent intelligence for your innovation.

Lactic acid bacteria antimicrobial peptides and their high expression and application of antibacterial and anticancer activities

A technology of antibacterial peptides and lactic acid bacteria, applied in medical preparations, applications, peptides and other directions containing active ingredients, to achieve the effects of strong stability, inhibition of value-added, and strong bacteriostatic ability

Active Publication Date: 2022-06-14
TIANJIN UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first two are not suitable for large-scale production due to high cost, and the method of genetic engineering expression is more and more recognized by everyone

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactic acid bacteria antimicrobial peptides and their high expression and application of antibacterial and anticancer activities
  • Lactic acid bacteria antimicrobial peptides and their high expression and application of antibacterial and anticancer activities
  • Lactic acid bacteria antimicrobial peptides and their high expression and application of antibacterial and anticancer activities

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of a novel lactic acid bacteria antimicrobial peptide LHH1, the nucleotide sequence of which is as follows;

[0039]

[0040] Bsa I and HindIII restriction endonuclease sites and protective bases were added to both ends, and the protective bases were part of the two tails. The amino acid sequence, molecular weight, charge number, isoelectric point and hydrophobicity of the antimicrobial peptide LHH1 are respectively: AFALIAGALYRIFHRR, 1875.25, +3, 11.71, 0.98.

[0041] The second technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned engineering bacteria. The technical scheme is as follows:

[0042] The present invention amplifies the gene sequence of antimicrobial peptide LHH1 by fully synthesizing it through PCR technology, and the primer sequence is:

[0043] F: TTTGGTCTCCAGGTGATGATGATGATAAAGCGTTTGCCTTAATCG

[0044] R: GGGGGGAAGCTTTCATTAACGACGATGAAATA

[0045] PCR reaction system: double di...

Embodiment 2

[0047] Construction of Antimicrobial Peptide LHH1 Recombinant Escherichia coli Genetic Engineering Bacteria

[0048] (1) Construction of cloning vector

[0049] The gene glue of the antimicrobial peptide was connected with pE-SUMO, transformed into the competent cells of Escherichia coli DH 5α, and the correctness of the test results was verified.

[0050] Preparation of competent cells: For specific methods, refer to the steps in the instructions of TaKaRa Competent Cell Preparation Kit (200 times).

[0051] Gel recovery of PCR products: For specific methods, refer to the steps in the instruction manual of the column-type small volume gel recovery kit. After completion, 5 μL of the recovered product was detected by electrophoresis on 2% Agarose gel containing EB.

[0052] Insert the LHH1 gene into the multiple cloning site of the Escherichia coli expression vector to construct the LHH1 recombinant plasmid: Digest the LHH1 gene and the pE-SUMO plasmid with Bsa I and HindIII,...

Embodiment 3

[0062] Induced Expression of Antimicrobial Peptide LHH1 Fusion Protein

[0063] The recombinant bacteria with correct sequencing results and the control bacteria containing empty vector were inoculated in LB (calamycin) liquid medium at an inoculum of 1%, and after culturing at 220r / min at 37°C overnight, inoculated at 10mL with an inoculum of 1%. LB (calamycin) liquid medium, 37 ° C, 220r / min shaking culture until OD 600 is 0.6, respectively take 1.0mL bacterial liquid as the pre-induction control (0h), and then add IPTG (final concentration 100mg / mL) to induce expression, continue to culture at 25°C, and take 1.0 mL of bacterial liquid 4 hours after induction, collect the bacterial cells by centrifugation at 12000r / min for 1min, and perform ultrasonic lysis. Ultrasonic crushing was performed at 180W for 20 minutes in ice water. Then, centrifuge at 12000r / min for 1min to collect the cell lysate, resuspend in PBS, take 10ul and add 40μL of 1× protein loading buffer, bath in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lactic acid bacteria antibacterial peptide and its high-efficiency expression and application of antibacterial and anticancer activities. By analyzing the gene map of Lactobacillus casei (L.casei HZ1), the gene sequence of the antibacterial peptide LHH1 is obtained, as shown in sequence 1, which simulates its The secondary structure determines the main physicochemical properties of the peptide. The LHH1 gene was optimized and fully synthesized according to the codon preference of lactic acid bacteria, and the gene fragment was cloned into the lactic acid bacteria expression vector pE‑SUMO to construct the pE‑SUMO‑EA‑LHH1 recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli Rosetta(DE3)pLysS, induced to express and isolated and purified. The antibacterial peptide LHH1 obtained by the method has strong thermal stability, good antibacterial and anticancer effects, and can be used as an excellent antiseptic additive and starter in industries such as food, medicine, and feed.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biotechnology, in particular to the high-efficiency expression of a novel lactic acid bacteria antibacterial peptide LHH1 and the application of antibacterial and anticancer activities. Background technique [0002] Since the 1990s, the research on new antibacterial substances such as antimicrobial peptides has been increasing. Among them, the family of antibacterial active peptides such as defensins and histatin (Histatin) is a natural component of the human immune system, which has strong antibacterial activity and less toxic side effects. , less drug-resistant strains and other advantages, has attracted much attention. Antimicrobial peptides are induced when the body is attacked by viruses, bacteria, etc., and are part of the innate immune mechanism of animals, plants, and humans. They have broad-spectrum antibacterial effects, especially for some pathogenic bacteria that are resistant t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/08C12N15/31C12N15/70A61K38/10A61P35/00
CPCC07K7/08C12N15/70A61P35/00A61K38/00
Inventor 罗学刚贺军芳金杜欣俞晓亭张同存
Owner TIANJIN UNIV OF SCI & TECH