Rubber tree U6 gene promoter proHbU6.6 and cloning and application of rubber tree U6 gene promoter proHbU6.6
A prohbu6.6-sk-5g, rubber tree technology, applied in the field of genetic engineering, can solve problems such as limited application, and achieve the effect of high-efficiency, precise varieties, and high-efficiency transcriptional activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] The acquisition of embodiment 1 Hevea brasiliensis U6 gene promoter proHbU6.6
[0052] Using the DNA sequences of Arabidopsis thaliana AtU6-26 gene (Genebank accession number: X52528.1) and cotton GhU6-9 gene (Genebank accession number: XR_001680717.1) as a reference, we searched the rubber tree genome database (hevea.catas. cn), found a rubber tree HbU6 gene (Genebank accession number: XR_002491077.1) by means of homologous alignment, and obtained the upstream reference sequence of this gene.
[0053] Using the genomic DNA of the leaves of Hevea brasiliensis Reyan 7-33-97 (developed by the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences) as a template, design the following proHbU6.6-F and proHbU6.6-R specific primers to clone the 462bp DNA of the promoter region Fragment:
[0054] proHbU6.6-F:ATCTAACATTGTCTTGCTTC;
[0055] proHbU6.6-R: CGGTTGCTCAATGCTTCGTG;
[0056] KOD FX enzyme (TOYOBO) was used to carry out PCR amplification in ...
Embodiment 2
[0059] The construction of embodiment 2 rubber tree gene editing vector
[0060] (1) proHbU6.6 was constructed on the intermediate vector SK-5G vector
[0061] Digest the SK-5G vector and the downstream gRNA fragment with SalI and XhoI, remove the rice U3 promoter on the vector, recover the 2913bp vector backbone fragment, and design primers:
[0062] proHbU6.6-lF:
[0063] GCGGCCGCAGATCTGCTAGCGTCGAC ATCTAACATTGTCTTGCTTC;
[0064] proHbU6.6-lR:
[0065] GGTGTTGTGTTCACCTGCGAGC CGGTTGCTCAATGCTTCGTG;
[0066] (The underlined sequence is homologous to the SK-5G vector).
[0067] Using the rubber tree genomic DNA as a template, use KOD FX enzyme (TOYOBO) in a 20 μl reaction system for pre-denaturation at 95°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles, and final extension at 72°C for 5 min. The proHbU6.6 promoter fragment was added, and the homologous sequence of SK-5G vector was introduced at its two ends. ...
Embodiment 3
[0083] Embodiment 3 Hevea protoplast transformation
[0084] In this example, the PEG-mediated editing vector proHbU6.6-sgRNA-163Cas9M was used to transform Hevea protoplasts, and the 163Cas9M vector without the sgRNA expression cassette was used as a control.
[0085] Transfer the rubber tree Reyan 7-33-97 tissue culture seedlings that have been cultivated for one month to 26-28°C for 5-7 days in the dark, and take 2g of leaves at the discoloration stage and immediately soak them in 0.6M mannitol solution for 10 minutes before preparing protoplast. The preparation and transformation process of protoplasts refer to (Yoo, S.D. et al., 2007, Nature Protocols, 2:1565-1575.). The transformed protoplasts were cultured in the dark at 26-28°C for 48 hours and then used for detection of target site mutations.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com