Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant plasmid used for synthesizing glutathione and preparation method thereof

A recombinant plasmid and glutathione technology, applied in the field of bioengineering, can solve problems such as unfavorable sustainable development, complicated operation steps, environmental damage, etc., and achieve the effects of improving efficiency, reducing degradation, reducing production costs and energy consumption

Pending Publication Date: 2019-10-01
张家港市华天药业有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In recent years, with the increasing demand for glutathione, the market urgently needs more glutathione. At present, the production methods of glutathione mainly include microbial fermentation, chemical synthesis, solvent extraction and enzyme-catalyzed synthesis. Among them, glutathione produced by chemical synthesis has the highest purity, but due to the complex operation steps of chemical synthesis, high cost, serious damage to the environment, and not conducive to the concept of sustainable development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid used for synthesizing glutathione and preparation method thereof
  • Recombinant plasmid used for synthesizing glutathione and preparation method thereof
  • Recombinant plasmid used for synthesizing glutathione and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Construction of pET-22b-GshF expression plasmid

[0041] 1.1 Primer design

[0042] According to the GshF sequence reported by NCBI, the following two primers were designed to amplify the GshF gene:

[0043] GshF-F: CAGCCGGCGATGGCCATGGATATGATAAAACTTGATATGA (SEQ ID NO. 3)

[0044] GshF-R: TGGTGGTGGTGGTGCTCGAGGTCAAATAAGAAATCTAAAAT (SEQ ID NO. 4)

[0045] Among them, GshF-F and GshF-R are used to amplify the GshF coding region; an NcoI restriction site is introduced into GshF-F, and an XhoI restriction site is introduced into GshF-R. The part of GshF-F and GshF-R homologous to pET-22b was used to clone the GshF gene into the pET-22b vector, and the kit used was ClonExpress II.

[0046] 1.2 PCR amplification of GshF sequence

[0047] The pMD19-T-GshF vector was obtained by extraction with the Sangon plasmid extraction kit.

[0048] Using the genome of Listeria monocytogenes as a template, use the GshF-F and GshF-R upstream and downstream primers designed in ...

Embodiment 2

[0057] Embodiment 2: optimization of fermentation conditions

[0058] Orthogonal test L9(3 4 ) optimize the temperature (°C), IPTG concentration (mM), fermentation pH, and reaction time (h), see Table 1 for detailed design,

[0059] Take the recombinant strain prepared in Example 1 at -80°C, add it into 10mL LB medium according to 1% volume ratio, cultivate overnight at 37°C, 180rpm, and inoculate it into 15mL LB medium according to 1% volume ratio the next day, according to Different conditions were optimized, and the final concentration of glutamic acid, cysteine, and glycine was 4mM. After the cultivation, 1mL of the bacterial liquid was taken and extracted with 40% ethanol at a ratio of 1:1, then vortexed, 12000rpm After centrifugation for 3 min, the supernatant was taken to determine the content of glutathione by the alloxan method.

[0060] Table 1

[0061] Level temperature °C IPTG concentration / mM pH Reaction time / h 1 16 0.1 3 6 2 25 ...

Embodiment 3

[0063] Embodiment 3 fermentation medium optimization

[0064] Orthogonal test L9(3 4 ) to optimize the carbon source, nitrogen source and ATP concentration, see Table 2 for detailed design.

[0065] Take the recombinant strain prepared in Example 1 at -80°C, add it into 10mL LB medium according to 1% volume ratio, cultivate overnight at 37°C, 180rpm, and inoculate 15mL of the following medium according to 1% volume ratio the next day, The final concentrations of glutamic acid, cysteine, and glycine were all 4mM, the concentration of IPTG was 0.5mM, the pH was adjusted to 5, and the reaction was carried out at 16°C for 12h. Extracted with 40% ethanol, then vortexed, centrifuged at 12000rpm for 3min, and the supernatant was taken for determination of glutathione content by the alloxan method.

[0066] Table 2

[0067]

[0068] Test results such as Figures 5 to 7 ,in, Figure 5 Adopt 10g / L beef extract as nitrogen source, under the condition that ATP concentration is 10m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant plasmid used for synthesizing glutathione and a preparation method thereof. The recombinant plasmid comprises a GshF fragment and a carrier fragment, and the carrier fragment is pET-22b. The recombinant plasmid can not only express the glutathione efficiently, but also reduce the degradation of the glutathione, the efficiency of glutathione synthesis is thusimproved, and the production cost and the energy consumption are reduced.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a recombinant plasmid for synthesizing glutathione and a preparation method thereof. Background technique [0002] Glutathione (γ-L-glutamyl-cysteinyl-glycine, GSH) is a kind of non-protein sulfhydryl compound in cells, which is formed by condensation of three amino acids, L-glutamic acid, L-cysteine ​​and glycine. A biologically active tripeptide, glutathione has free sulfhydryl groups and redox ability. It is the most abundant antioxidant in cells and can protect DNA and proteins from ROS damage. In addition, glutathione also participates in cell Signal transduction is an essential substance to maintain the normal physiological activities of cells; at the same time, glutathione can also enhance the body's immunity and play an antiviral role. In the food industry, dairy products and meat that contain or add glutathione can improve the fresh-keeping ability of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K5/02C12P21/02C12N1/21C12N15/70C12R1/19
CPCC12P21/02C12N15/70C07K5/0215
Inventor 徐继嗣许激扬
Owner 张家港市华天药业有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More