High-efficient accurate targeted gene integration system and application thereof
A targeting and gene technology, applied in the field of genetic engineering and biology, can solve the problems of low efficiency, lack of advantages, inconvenient experiments, etc., and achieve the effect of efficient gene integration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Example 1 pCAG-SB100X-mChery plasmid ( figure 2 )Construct
[0077] Design and synthesize the SB100X-Template plasmid, the specific sequence is as follows:
[0078] ACCGGTGGTGGAGGCGGAGGTTCTGGGGGAGGAGGTAGTGGCGGTGGTGGTTCAGGAGGCGGCGGAAGCTTGGATCCAGGTGGAGGTGGAAGCGGTGTTAACATGGGAAAATCAAAAGAAATCAGCCAAGACCTCAGAAAAAGAATTGTAGACCTCCACAAGTCTGGTTCATCCTTGGGAGCAATTTCCAAACGCCTGGCGGTACCACGTTCATCTGTGCAAACAATAGTACGCAAGTATAAACACCATGGGACCACGCAGCCGTCATACCGCTCAGGAAGGAGACGCGTTCTGTCTCCTAGAGATGAACGTACTTTGGTGCGAAAAGTGCAAATCAATCCCAGAACAACAGCAAAGGACCTTGTGAAGATGCTGGAGGAAACAGGTACAAAAGTATCTATATCCACAGTAAAACGAGTCCTATATCGACATAACCTGAAAGGCCACTCAGCAAGGAAGAAGCCACTGCTCCAAAACCGACATAAGAAAGCCAGACTACGGTTTGCAACTGCACATGGGGACAAAGATCGTACTTTTTGGAGAAATGTCCTCTGGTCTGATGAAACAAAAATAGAACTGTTTGGCCATAATGACCATCGTTATGTTTGGAGGAAGAAGGGGGAGGCTTGCAAGCCGAAGAACACCATCCCAACCGTGAAGCACGGGGGTGGCAGCATCATGTTGTGGGGGTGCTTTGCTGCAGGAGGGACTGGTGCACTTCACAAAATAGATGGCATCATGGACGCGGTGCAGTATGTGGATATATTGAAGCAACATCTCAAGACATCAGTCAGGAAGTTAAAGCTTGGTCGCAAATGG...
Embodiment 2
[0091] Example 2 pCAG-Cas9-SB100X plasmid ( image 3 )Construct
[0092] Cut the pCAG-Cas9-mChery plasmid (see below for details) with AgeI+BsrGI restriction endonuclease ( figure 1 ) and the SB100X-Template plasmid, the enzyme product was analyzed by 0.8% agarose gel electrophoresis, the 8570bp and 1152bp bands were recovered by cutting the gel, and the concentration of the recovered fragment was determined by NanoDrop. The linearized pCAG-Cas9-mChery plasmid was combined with the SB100X- The template was ligated by T4 DNA ligase purchased from NEB Company (see below for details), and then the ligated product was transformed into TOP10 Escherichia coli, spread on an LB solid plate containing 100 μg / mL ampicillin, cultured overnight at 37°C, and then picked a single clone , 37 ℃ 250rpm shaking bacteria, extraction of plasmids for DNA sequencing, thus screening to construct the vector, named pCAG-Cas9-SB100X ( image 3 ).
[0093] Enzyme digestion system 50μL, including:
...
Embodiment 3
[0098] Example 3 pCAG-Cas9-N123 plasmid ( Figure 4 )Construct
[0099] PCR was carried out using the SB100X-Template plasmid as a template, and the PCR primer sequences were designed and synthesized as follows:
[0100] N57-123-OL-F: CAAGAAGAAGAGGAAGGTGACCGGTGGTGGAGGCGGAGGTTCTGG (SEQ ID NO: 4)
[0101] N123-OL-R: AGATCCCCGCGCTGCAGTTACTTGTACATATAGCGGCCGCTCAGAGCAGTGGCTTCTTC (SEQ ID NO: 5)
[0102] Cut the pCAG-Cas9-mChery plasmid (see below for details) with AgeI+BsrGI restriction endonuclease ( figure 1 ), use 0.8% agarose gel electrophoresis to analyze the enzyme product and PCR (see below) product, cut the gel and recover the 8570bp and 533bp bands respectively, and utilize NanoDrop to measure the concentration of the recovered fragment, and the linearized pCAG-Cas9-mChery plasmid Ligate the PCR product with the Gibsion Assembly ligation kit purchased from NEB Company (see below for details), then transform the ligated product into TOP10 Escherichia coli, spread it on an ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


