Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific HPV nucleic acid detection method based on CRISPR/Cas12a

A detection method and nucleic acid technology, applied in the field of molecular biology, can solve the problems of inability to realize point-of-care testing, bedside diagnosis, inability to meet the needs of primary inspection, false positives in PCR detection, etc., and achieve low detection cost, excellent effect, and good specificity. Effects of Sex and Compatibility

Active Publication Date: 2019-11-01
GUANGZHOU PLUSLIFE TECH CO LTD
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main disadvantage of this method is that it needs to rely on a PCR machine or an expensive real-time quantitative PCR machine, and other supporting equipment, as well as a dedicated PCR laboratory and professional operators for PCR testing.
PCR detection cannot realize instant detection, bedside diagnosis and scene application without specific laboratory detection conditions, so it cannot meet the inspection needs of grassroots, user terminals, and on-site
At the same time, PCR detection may have problems such as false positives and insufficient sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific HPV nucleic acid detection method based on CRISPR/Cas12a
  • Specific HPV nucleic acid detection method based on CRISPR/Cas12a
  • Specific HPV nucleic acid detection method based on CRISPR/Cas12a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Discovery of HPV18 nucleic acid detection sites based on CRISPR / Cas12a system

[0027] We obtained the HPV18 genome sequence, compared it through bioinformatics analysis, and intercepted the conserved regions in different HPV18 isolates. At the same time, by comparing with other HPV subtypes, such as HPV16, the specific identification region of HPV18 was confirmed. After a lot of exploratory experiments, gRNAs were designed for different regions and a CRISPR / Cas12a system was constructed for research. The results show that the HPV18 nucleic acid detection site based on the CRISPR / Cas12a system has a good detection effect by using any of the region sequences shown in SEQ ID NO.1-7.

[0028] SEQ ID NO.1:

[0029]gatgacactgaaagttcccatgccgccacgtctaatgtttctgaggacgttagggacaatgtgtctgtagattataagcagacacagttatgtattttgggctgtgcccctgctattggggaacactgggctaaaggcactgcttgtaaatcgcgtcctttaTCACAGGGCGATTGCCCCCCtttaGAACTTAAAAACACAGTTTTggaagatggtgatatggtagatactggatatgGTGCCATGGACTTT...

Embodiment 2

[0039] Example 2 Discovery of HPV16 nucleic acid detection sites based on the CRISPR / Cas12a system We obtained the HPV16 genome sequence, compared it through bioinformatics analysis, and intercepted the conserved regions in different HPV16 isolates. At the same time, by comparing with other HPV subtypes, such as HPV16, the specific identification region of HPV16 was confirmed. After a lot of exploratory experiments, gRNAs were designed for different regions and a CRISPR / Cas12a system was constructed for research. The results show that the HPV16 nucleic acid detection site based on the CRISPR / Cas12a system has a good detection effect by using any of the region sequences shown in SEQ ID NO.8-9.

[0040] SEQ ID NO.8:

[0041] TTTTGTAAATTCTAAAAGCCATTTTTGGTTACAACCATTAGCAGATGCCAAAATAGGTATGTTAGATGATGCTACAGTGCCCTGTTGGAACTATATAGATGACAATTTAAGAAATGCATTGGATGGAAATTTAGTTTCTATGGATGTAAAGCATAGACCATTGGTACAACTAAAATGCCCTCCATTATTAATTACATCTAACATTAATGCTGGTACAGATTCTAGGTGGCCTTATTTACATAATAGATTGGTGGTGT...

Embodiment 3

[0044] Example 3 HPV nucleic acid detection case based on CRISPR / Cas12a system

[0045] 1. CRISPR / Cas12a gene cloning and protein expression

[0046] The Cas12a protein gene derived from Lachnospiraceae bacterium is used, and the codon is optimized to make the gene more suitable for expression in mammalian cells. The optimized Cas12a protein gene was cloned into the pET28a plasmid with a 6-His histidine tag to facilitate protein purification and expression. The Cas12a protein recombinant expression vector was transformed, and the expression strain was BL21 star (DE3).

[0047] The specific protein expression conditions are: in culture solution OD 600 When =0.6, add 0.5mMIPTG and cultivate for 4 hours. Bacteria were collected for protein purification. The purification conditions are: resuspend the bacteria in the lysate (50mM Tris, pH8.0, 300mM NaCl, 5% glycerol, 20mM imidazole), and perform sonication (70% amplitude, 2s On / 4s Off, 3 minutes, Sonics 750w ultrasonic instrum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific HPV nucleic acid detection method based on CRISPR / Cas12a. Through research, the inventor finds an HPV nucleic acid detection site. In accordance with the site, a CRISPR / Cas12a system can be used for realizing HPV nucleic acid detection, and a specific HPV nucleic acid detection system and a detection reagent kit based on CRISPR / Cas12a can be constructed. The technique has good specificity and high sensitivity for HPV nucleic acid detection, and can realize simultaneous detection of various virus subtypes. The technique is convenient and quick to operate, canbe performed at the room temperature of 25-37 DEG C, is low in detection cost, and has wide application prospects.

Description

technical field [0001] The invention belongs to the technical field of molecular biology. More specifically, it relates to a specific HPV nucleic acid detection method based on CRISPR / Cas12a. Background technique [0002] Human papillomavirus (HPV) is a papillomavirus A genus of the family Papovaviridae and is a sexually transmitted disease caused by spherical DNA virus infection. The main types are HPV1, 2, 6, 11, 16, 18, 31, 33 and 35, etc. Long-term infection of HPV16 and 18 may be related to female cervical cancer. In order to realize the early detection of HPV and minimize the spread of drug-resistant bacteria, it is very important to develop low-cost, accurate, efficient and rapid diagnostic methods for detecting HPV-related specific genes. [0003] Determination of susceptibility or resistance using classical culture-based phenotypic assays is a general approach used in clinical microbiology laboratories, but due to variable levels of enzyme expression and poor spec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12N15/113C12R1/93
CPCC12Q1/708C12Q1/6844C12Q2521/507C12Q2521/301C12Q2563/107Y02A50/30
Inventor 胡洋刘华勇季宇
Owner GUANGZHOU PLUSLIFE TECH CO LTD