Specific HPV nucleic acid detection method based on CRISPR/Cas12a
A detection method and nucleic acid technology, applied in the field of molecular biology, can solve the problems of inability to realize point-of-care testing, bedside diagnosis, inability to meet the needs of primary inspection, false positives in PCR detection, etc., and achieve low detection cost, excellent effect, and good specificity. Effects of Sex and Compatibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Discovery of HPV18 nucleic acid detection sites based on CRISPR / Cas12a system
[0027] We obtained the HPV18 genome sequence, compared it through bioinformatics analysis, and intercepted the conserved regions in different HPV18 isolates. At the same time, by comparing with other HPV subtypes, such as HPV16, the specific identification region of HPV18 was confirmed. After a lot of exploratory experiments, gRNAs were designed for different regions and a CRISPR / Cas12a system was constructed for research. The results show that the HPV18 nucleic acid detection site based on the CRISPR / Cas12a system has a good detection effect by using any of the region sequences shown in SEQ ID NO.1-7.
[0028] SEQ ID NO.1:
[0029]gatgacactgaaagttcccatgccgccacgtctaatgtttctgaggacgttagggacaatgtgtctgtagattataagcagacacagttatgtattttgggctgtgcccctgctattggggaacactgggctaaaggcactgcttgtaaatcgcgtcctttaTCACAGGGCGATTGCCCCCCtttaGAACTTAAAAACACAGTTTTggaagatggtgatatggtagatactggatatgGTGCCATGGACTTT...
Embodiment 2
[0039] Example 2 Discovery of HPV16 nucleic acid detection sites based on the CRISPR / Cas12a system We obtained the HPV16 genome sequence, compared it through bioinformatics analysis, and intercepted the conserved regions in different HPV16 isolates. At the same time, by comparing with other HPV subtypes, such as HPV16, the specific identification region of HPV16 was confirmed. After a lot of exploratory experiments, gRNAs were designed for different regions and a CRISPR / Cas12a system was constructed for research. The results show that the HPV16 nucleic acid detection site based on the CRISPR / Cas12a system has a good detection effect by using any of the region sequences shown in SEQ ID NO.8-9.
[0040] SEQ ID NO.8:
[0041] TTTTGTAAATTCTAAAAGCCATTTTTGGTTACAACCATTAGCAGATGCCAAAATAGGTATGTTAGATGATGCTACAGTGCCCTGTTGGAACTATATAGATGACAATTTAAGAAATGCATTGGATGGAAATTTAGTTTCTATGGATGTAAAGCATAGACCATTGGTACAACTAAAATGCCCTCCATTATTAATTACATCTAACATTAATGCTGGTACAGATTCTAGGTGGCCTTATTTACATAATAGATTGGTGGTGT...
Embodiment 3
[0044] Example 3 HPV nucleic acid detection case based on CRISPR / Cas12a system
[0045] 1. CRISPR / Cas12a gene cloning and protein expression
[0046] The Cas12a protein gene derived from Lachnospiraceae bacterium is used, and the codon is optimized to make the gene more suitable for expression in mammalian cells. The optimized Cas12a protein gene was cloned into the pET28a plasmid with a 6-His histidine tag to facilitate protein purification and expression. The Cas12a protein recombinant expression vector was transformed, and the expression strain was BL21 star (DE3).
[0047] The specific protein expression conditions are: in culture solution OD 600 When =0.6, add 0.5mMIPTG and cultivate for 4 hours. Bacteria were collected for protein purification. The purification conditions are: resuspend the bacteria in the lysate (50mM Tris, pH8.0, 300mM NaCl, 5% glycerol, 20mM imidazole), and perform sonication (70% amplitude, 2s On / 4s Off, 3 minutes, Sonics 750w ultrasonic instrum...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


