Adhesin aptamer and screening method and application thereof
A technology of nucleic acid aptamers and screening methods, which can be applied in the direction of pharmaceutical formulations, microbial-based methods, biochemical equipment and methods, etc., and can solve the problems of unstandardized culture technology, commercialization, interpretation impact, and insufficient judgment of patients' course of disease, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Embodiment 1, the screening of aptamer
[0047] 1. Experimental materials
[0048]Strain source: Hp ATCC26695 strain was from Jiangsu University.
[0049] ssDNA library:
[0050] 5'-C GGATCC ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3’
[0051] and primer P1: 5'-C GGATCC ATCCAGAGTGACGCAGCA-3'
[0052] Primer P2: 5'-G AAGCTT ACTAAGCCACCGTGTCCA-3'; all provided by Shanghai Bioengineering Company.
[0053] Columbia medium was purchased from Qingdao Haibo Biotechnology Company.
[0054] Fetal bovine serum was purchased from Gibco.
[0055] Restriction enzymes BamH I, Hind III and T4 ligase were purchased from Fermentas.
[0056] DNA markers and protein markers were purchased from Beijing Lamboride Biological Company.
[0057] Microaerophilic air bags were purchased from Mitsubishi Corporation.
[0058] The PCR mix reaction solution was purchased from Thermo Company.
[0059] Kanamycin and gentamicin were purchased from Sigma.
Embodiment 2
[0091] Example 2, Aptamer Detection Efficiency Verification
[0092] The plasmids of the two aptamers obtained from the final screening after positive enzyme digestion were sequenced, and the FAM-labeled core region sequence was synthesized. The two aptamers were used to detect HP in gastric mucosal tissue sections. Make frozen sections of the fresh gastric mucosa taken out, fix them on polylysine-treated glass slides, put the synthesized FAM-labeled aptamer at a concentration of 10 μmol and cover the detection area, incubate in the dark for 20 minutes, and screen the buffer The slides were washed 5 times, dried and examined with a fluorescence microscope.
[0093] The final primary sequence of the aptamer is:
[0094] CGTTACGATCGGATCCAATGCATTTGCGCATATCGTAACCGATAG, ie, SEQ ID NO.1.
[0095] Observe the fluorescence under a fluorescence microscope, if there is fluorescence, it is marked as positive: (+); if no fluorescence is marked as negative: (-), such as Figure 11 shown...
Embodiment 3
[0099] Example 3 Flow cytometric detection of HA6 blocking the combination of HP and GES-1 cells
[0100] Rhodamine B was used to stain HP, and different doses of aptamer HA6 were added to combine with GES-1 cells after incubation, and the proportion of attached Hp on GES-1 cells was detected by flow cytometry, as shown in Figure 12 shown.
[0101] Existing studies have analyzed the structure of prokaryotically expressed adhesin, which is consistent with the natural adhesin structure, so it is feasible to screen ligands for its three-dimensional conformation. The present invention selects HpaA with higher abundance based on the detection of Hp in gastric mucosa. The invention analyzes the 260 amino acid functional region of the protein, the 1-27 amino acid is a signal peptide, and the 134-139 amino acid is a combined functional region, and then the gene encoding the 28-259 amino acid is amplified and cloned.
[0102] During the purification process, the Ni-NAT affinity chro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


