Unlock instant, AI-driven research and patent intelligence for your innovation.

Adhesin aptamer and screening method and application thereof

A technology of nucleic acid aptamers and screening methods, which can be applied in the direction of pharmaceutical formulations, microbial-based methods, biochemical equipment and methods, etc., and can solve the problems of unstandardized culture technology, commercialization, interpretation impact, and insufficient judgment of patients' course of disease, etc. question

Inactive Publication Date: 2020-01-10
皖南医学院第二附属医院
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the C14 breath test is more or less harmful to the health of infants and minors due to certain radioactivity; and the recent use of antibiotics and the degree of fasting will also affect the interpretation of the breath test results
The rapid urease test often has a certain degree of false negative due to the relationship between the number of Hp in the sample and the recent use of antibiotics.
At present, the detection of Hp antibodies in peripheral blood commonly used in clinical laboratories is more extensive, but there are still deficiencies in the judgment of the disease course of patients
Moreover, the current culture technology is still not standardized and commercialized, and there is an urgent need for a detection method that can supplement the above methods.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adhesin aptamer and screening method and application thereof
  • Adhesin aptamer and screening method and application thereof
  • Adhesin aptamer and screening method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1, the screening of aptamer

[0047] 1. Experimental materials

[0048]Strain source: Hp ATCC26695 strain was from Jiangsu University.

[0049] ssDNA library:

[0050] 5'-C GGATCC ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3’

[0051] and primer P1: 5'-C GGATCC ATCCAGAGTGACGCAGCA-3'

[0052] Primer P2: 5'-G AAGCTT ACTAAGCCACCGTGTCCA-3'; all provided by Shanghai Bioengineering Company.

[0053] Columbia medium was purchased from Qingdao Haibo Biotechnology Company.

[0054] Fetal bovine serum was purchased from Gibco.

[0055] Restriction enzymes BamH I, Hind III and T4 ligase were purchased from Fermentas.

[0056] DNA markers and protein markers were purchased from Beijing Lamboride Biological Company.

[0057] Microaerophilic air bags were purchased from Mitsubishi Corporation.

[0058] The PCR mix reaction solution was purchased from Thermo Company.

[0059] Kanamycin and gentamicin were purchased from Sigma.

[0060] Mandarin fish sperm DNA w...

Embodiment 2

[0091] Example 2, Aptamer Detection Efficiency Verification

[0092] The plasmids of the two aptamers obtained from the final screening after positive enzyme digestion were sequenced, and the FAM-labeled core region sequence was synthesized. The two aptamers were used to detect HP in gastric mucosal tissue sections. Make frozen sections of the fresh gastric mucosa taken out, fix them on polylysine-treated glass slides, put the synthesized FAM-labeled aptamer at a concentration of 10 μmol and cover the detection area, incubate in the dark for 20 minutes, and screen the buffer The slides were washed 5 times, dried and examined with a fluorescence microscope.

[0093] The final primary sequence of the aptamer is:

[0094] CGTTACGATCGGATCCAATGCATTTGCGCATATCGTAACCGATAG, ie, SEQ ID NO.1.

[0095] Observe the fluorescence under a fluorescence microscope, if there is fluorescence, it is marked as positive: (+); if no fluorescence is marked as negative: (-), such as Figure 11 shown...

Embodiment 3

[0099] Example 3 Flow cytometric detection of HA6 blocking the combination of HP and GES-1 cells

[0100] Rhodamine B was used to stain HP, and different doses of aptamer HA6 were added to combine with GES-1 cells after incubation, and the proportion of attached Hp on GES-1 cells was detected by flow cytometry, as shown in Figure 12 shown.

[0101] Existing studies have analyzed the structure of prokaryotically expressed adhesin, which is consistent with the natural adhesin structure, so it is feasible to screen ligands for its three-dimensional conformation. The present invention selects HpaA with higher abundance based on the detection of Hp in gastric mucosa. The invention analyzes the 260 amino acid functional region of the protein, the 1-27 amino acid is a signal peptide, and the 134-139 amino acid is a combined functional region, and then the gene encoding the 28-259 amino acid is amplified and cloned.

[0102] During the purification process, the Ni-NAT affinity chro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an adhesin aptamer, and a method for screening the adhesin aptamer. The method comprises the steps that DNA of a helicobacter pylori (Hp) genome is taken as a template, amplification is conducted to obtain adhesin genes of Hp, the obtained genes are connected with an expression vector to obtain a screening target, then the screening target and a random single-stranded ssDNAlibrary are incubated, screening of systematic evolution of ligands by exponential enrichment (SELEX) is conducted, the library is subjected to PCR amplification, and then multiple rounds of screening are conducted to obtain the adhesin aptamer. The invention further discloses application of the adhesin aptamer to preparation of a detection kit of the Hp and preparation of helicobacter pylori immune drugs. The adhesin aptamer has high affinity and specificity, is small in molecular weight and high in permeability, and compared with the prior art, the condition of organisms infected with Hp can be reflected more visually.

Description

technical field [0001] The invention relates to a nucleic acid aptamer and its screening and application, in particular to a nucleic acid aptamer which can be used to detect Helicobacter pylori and its screening method and application. Background technique [0002] Nucleic acid aptamers are ligands with high specificity and high affinity for target substances screened from random single-stranded oligonucleotide libraries using exponential enrichment ligand system evolution technology (Systematic Evolution of Ligands by Exponential Enrichment, SELEX). body. The nucleic acid aptamers screened by SELEX have the advantages of high affinity, stable performance, low molecular weight, low immunogenicity, easy modification and no side effects. [0003] Helicobacter pylori (H. pylori, Hp) infection is closely related to the high incidence of gastric cancer. The global H. pylori infection rate is about 50%, the infection rate in Asia is as high as 70%, and the average infection rate ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115C12N15/70G01N33/569A61K39/02A61P31/04C12R1/01
CPCC12N15/115C12N15/70G01N33/56911A61K39/105A61P31/04C12N2310/16
Inventor 唐晓磊华影周发友章宏祥黄友明
Owner 皖南医学院第二附属医院