Preparation method of long single-chain DNA

A single-strand, sequence technology, applied in the field of preparation of long single-strand DNA, can solve the problem that the single-strand DNA sequence cannot be customized, and achieve the effect of efficient cutting, high-efficiency preparation, and high purity

Pending Publication Date: 2020-01-17
FUNDAN UNIVERSITY SHANGHAI CANER CENTER
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, class I deoxyribozyme is used for cleavage reaction, and the resulting single-stranded DNA has two AG bases at the 5' end and five GTTGA bases at the 3' end, which cannot completely customize the single-stranded DNA sequence. Can not fully meet the needs of practical applications such as probe preparation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of long single-chain DNA
  • Preparation method of long single-chain DNA
  • Preparation method of long single-chain DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Deoxyribozyme combined with helper phage to prepare single-stranded DNA

[0035] Using mEGFP as a template, PCR primers were designed to amplify the target fragment.

[0036] Such as figure 2 As shown in (a), when the deoxyribozyme is split into a substrate chain and an enzyme chain, and when cutting occurs in the form of two sequences, the class I deoxyribozyme substrate sequence is added to the forward primer, and the reverse The substrate sequence of class II deoxyribozyme mutants was added to the primers, and on this basis, BamH I and Hind III restriction sites were added to the 5' ends of the forward and reverse primers, respectively. Wherein, according to the last base at the 3' end of the single-stranded sequence to be prepared, the corresponding class II deoxyribozyme mutant is selected. If the last base at the 3' end is G, select II-R1a; if the last base at the 3' end is A, select II-R1b; if the last base at the 3' end is T, select II-R1c; such as ...

Embodiment 2

[0055] Taking 60nt and 160nt sequences as examples, the purity of single-stranded DNA prepared by the present invention was compared with that of chemically synthesized single-stranded DNA.

[0056] The method described in Example 1 was used to prepare 60 nt single-stranded DNA. The same sequence chemically synthesized was ordered from the company, and the purification method was polyacrylamide gel purification. A part of the sample was purified by polyacrylamide gel again in the laboratory. By performing 12% polyacrylamide gel (Acr / Bis 19:1) electrophoresis, the purity of the single-chain sample prepared by this method and the single-chain sample after purification by chemical synthesis was compared. The result is as Figure 5 Shown in (a), swimming lane A is the 60nt single strand obtained by chemical synthesis and purification once, swimming lane B is the 60nt single strand obtained by chemical synthesis and purification twice, and swimming lane C is the 60nt single stran...

Embodiment 3

[0059] The knock in experiment of mEGFP targeting microtubule TUBA1B gene, the experimental principle is as follows Figure 6 shown. The single-stranded DNA with a length of 1570 nt prepared in Example 1 of the present invention is used as a single-stranded DNA repair template, and its application in the knock in experiment. Specific steps are as follows,

[0060] 1. Cell culture. Hek293T cells were purchased from the Cell Bank of Shanghai Type Culture Collection Committee, Chinese Academy of Sciences. The culture condition is DMEM medium containing 10% FBS (inactivated), which contains 50 units / mL of penicillin, 50 μg / mL of streptomycin, and 4 mM of glutamine. Place at 37°C, 5% CO 2 Concentration in a constant temperature incubator.

[0061] 2. Construction of CRISPR / Cas9 plasmid vector targeting microtubule TUBA1B gene.

[0062](1) Synthesis of sgRNA double-stranded fragments. The sgRNA sequence targeting the human TUBA1B gene is TGGAGATGCACTCACGCTGC (SEQ ID NO: 16) (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for efficiently preparing long single-chain DNA by means of class I and class II hydrolysable deoxyribozymes. The method mainly comprises steps of designing and constructing recombinant phagemids to obtain phagemid circular single-chain DNA, at the same time, the class I deoxyribozyme and class II deoxyribozyme mutants are used to cut the circular single-chain DNA, and the long single-chain DNA is obtained by purifying, recovering and enzyme digestion. The two types of the deoxyribozymes capable of rapidly hydrolyzing DNA are used to replace restrictionendonucleases, the preparation method realizes specific cleavage of the prepared DNA sequences by an assisted phage method in a low cost manner, and the single-chain DNA with any length and sequencesis prepared in a large amount, economic and high-purity manner.

Description

technical field [0001] The invention belongs to the fields of biochemistry and molecular biology, and specifically relates to a method for preparing long single-stranded DNA by using two types of deoxyribozymes capable of rapidly hydrolyzing DNA and combining with helper phages. Background technique [0002] At present, DNA nanotechnology, gene editing such as knock in (gene knock-in) and other biomedical research fields have a wide demand for single-stranded DNA (Single strand DNA, ssDNA), especially for long single-stranded DNA (>100 bases). However, limited by chemical synthesis methods, the synthesis of long single-stranded DNA is difficult to guarantee yield, yield and satisfactory cost performance. Therefore, for long single-stranded DNA, it is necessary to rely on the in vivo or in vitro action of biological enzymes and some means of assisted denaturation. Commonly used methods for preparing long single-stranded DNA mainly include reverse transcription, enzymatic d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/34C12N9/22
CPCC12P19/34C12N9/22Y02A50/30
Inventor顾宏周张俏夏凯
OwnerFUNDAN UNIVERSITY SHANGHAI CANER CENTER