Preparation method of long single-chain DNA
A single-strand, sequence technology, applied in the field of preparation of long single-strand DNA, can solve the problem that the single-strand DNA sequence cannot be customized, and achieve the effect of efficient cutting, high-efficiency preparation, and high purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0034] Example 1 Preparation of single-stranded DNA by combining deoxyribozyme with helper phage
[0035] Using mEGFP as a template, PCR primers were designed to amplify the target fragment.
[0036] Such as figure 2 As shown in (a), when the deoxyribozyme is split into a substrate chain and an enzyme chain, and the cleavage occurs in the form of two sequences, add the type I deoxyribozyme substrate sequence to the forward primer, and in the reverse The primers were added with a class II deoxyribozyme mutant substrate sequence, and on this basis, BamH I and Hind III restriction sites were added to the 5'ends of the forward and reverse primers, respectively. Among them, according to the last base at the 3'end of the single-stranded sequence to be prepared, the corresponding class II deoxyribozyme mutant is selected. If the last base at the 3'end is G, select II-R1a; if the last base at the 3'end is A, select II-R1b; if the last base at the 3'end is T, select II-R1c; such as 3 The...
Example Embodiment
[0054] Example 2
[0055] Taking 60nt and 160nt sequences as an example, the purity of the single-stranded DNA prepared by the present invention and the chemically synthesized single-stranded DNA are compared.
[0056] The method described in Example 1 was used to prepare 60 nt single-stranded DNA. Order the same sequence chemically synthesized from the company, and the purification method is polyacrylamide gel purification. Take a part of the sample and perform polyacrylamide gel purification again in the laboratory. By performing 12% polyacrylamide gel (Acr / Bis 19:1) electrophoresis, the purity of the single-stranded sample prepared by this method and the single-stranded sample after chemical synthesis and purification was compared. The result is Figure 5 As shown in (a), lane A is a 60nt single-strand obtained by chemical synthesis and purification once, lane B is a 60nt single-strand obtained by chemical synthesis and purification twice, lane C is a 60nt single-stranded samp...
Example Embodiment
[0058] Example 3
[0059] The knock in experiment of mEGFP targeting the microtubule TUBA1B gene is as follows: Image 6 Shown. The single-stranded DNA with a length of 1570 nt prepared in Example 1 of the present invention is used as a template for single-stranded DNA repair and is used in the knock in experiment. Specific steps are as follows,
[0060] 1. Cell culture. Hek293T cells were purchased from the cell bank of the Shanghai Type Culture Collection Committee of the Chinese Academy of Sciences. The culture condition is DMEM medium containing 10% FBS (inactivated), which contains penicillin 50 units / mL, streptomycin 50 μg / mL, and glutamine 4 mM. Place at 37℃, 5% CO 2 Cultivate in a constant temperature incubator with concentration.
[0061] 2. Construction of CRISPR / Cas9 plasmid vector targeting the TUBA1B gene of microtubules.
[0062] (1) Synthesis of sgRNA double-stranded fragments. The sgRNA sequence targeting human TUBA1B gene is TGGAGATGCACTCACGCTGC (SEQ ID NO: 16) (...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap