High-throughput identification method of internal ribosome entry site (IRES) elements in various source cell samples

A technology of binding sites and identification methods, applied in nucleic acid vectors, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems of unreal results, increased capital investment, low throughput, etc., and achieve a clear purpose , improve the accuracy, the effect of the process is simple

Active Publication Date: 2020-02-21
XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods also have limitations. For example, there may be no IRES element in the mRNA bound to ribosomes, so the detection results cannot be obtained at one time, or the method of identifying translation activity in vitro ignores the influence of the cellular microenvironment on its IRES activity. influence, so that the results obtained are not real
Therefore, the identification of IRES elements using the reporter gene system is still the gold standard, and the results of these methods still need to be verified by the reporter gene system, so the problem of low throughput has not been solved
[0005] 3. Subsequently, some studies used fluorescence sorting technology to detect artificially synthesized nucleic acid sequences, but this technology did not design IRES components for cell sample sources, and this technology only copied the traditional IRES component detection mode , so additional high-throughput experiments are still needed to rule out false positive results that may be caused by promoter activity and alternative splicing sites
For high-throughput detection, the complexity of the steps not only increases the investment of funds, but also because of the long process, the possible differences between multiple high-throughput results will affect the interpretation of the results.
[0006] In summary, it is imminent to establish a high-throughput, targeted, and relatively simple method for the identification of IRES elements contained in cell samples from multiple sources, but there is no method that can solve the above limitations. It is established

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-throughput identification method of internal ribosome entry site (IRES) elements in various source cell samples
  • High-throughput identification method of internal ribosome entry site (IRES) elements in various source cell samples
  • High-throughput identification method of internal ribosome entry site (IRES) elements in various source cell samples

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The high-throughput identification method for internal ribosome binding site elements in cell samples from multiple sources comprises the following steps:

[0038]1. Use the RNA extraction reagent Trizol to extract the total RNA from cells. Use the Nanodrop spectrophotometer to detect the concentration of the extracted total RNA, and use two oligomer cores designed to bind to the 5'-end cap structure and the 3'-end polyadenylic acid tail sequence on the mRNA chain respectively The nucleotide chain undergoes reverse transcription. The sequence of the oligonucleotide chain is: an oligonucleotide (5'-3') capable of binding to the 5'-end cap structure: AAGCAGTGGTATCAACGCAGAGTACATGGG (SEQ ID NO.1; wherein, the penultimate and penultimate Three Gs are ribonucleotide bases G; the last G is a locked nucleotide base G); the rest are composed of deoxyribonucleotide bases marked in the sequence), which can bind to the 3'-terminal polyadenylation Oligonucleotide (5'-3') of nucleo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-throughput identification method of internal ribosome entry site (IRES) elements in various source cell samples. The method comprises the following steps: a full-lengthcDNA library is obtained from a sample by utilizing oligonucleotides designed for an mRNA chain 5'- terminal cap structure and a 3'-terminal polyadenylic acid tail through reverse transcription; the cDNA library is fragmented by utilizing TN5 transposase and a designed nucleic acid fragment containing a special linker sequence; active IRES elements are screened by utilizing a lentivirus reporter gene plasmid vector containing red fluorescent proteins, green fluorescent proteins and special elements, and false positive results caused in a translation process are eliminated; and the active IRESelements are identified by utilizing a long reading and long sequencing technology and false positive results caused by a promoter and variable shearing in the transcription process are eliminated. The method pushes high-throughput identification of IRES elements to clinical application, so that a role played by the IRES elements in a process of disease occurrence and development can be deeply studied.

Description

technical field [0001] The invention belongs to the technical field of biochemistry, and in particular relates to a high-throughput identification method for internal ribosome binding site elements in cell samples from various sources. Background technique [0002] Internal ribosome binding site (IRES) elements are a class of nucleic acid elements located in mRNA that have been found to be involved in important functions such as development and stress in humans in recent years. Due to its particularity and importance, it is particularly important to screen which mRNAs contain IRES elements to study their roles in various life activities. Current methods for the identification of IRES elements have several limitations: [0003] 1. The traditional IRES component identification method uses the dual-luciferase reporter gene system, that is, the sequence with potential IRES activity is obtained through molecular cloning technology and inserted into the reporter gene carrier, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6869C12Q1/6897C12N15/867C12N15/65
CPCC12Q1/6869C12Q1/6897C12N15/86C12N15/65C12N2740/15043C12N2800/107C12N2840/206C12Q2535/122Y02A50/30
Inventor尹继业王蕾云郭成贤
OwnerXIANGYA HOSPITAL CENT SOUTH UNIV