Application of ahl4 in regulating plant lipid metabolism and method for increasing plant seed oil content and unsaturated fatty acid content

A plant seed, 1. AHL4 technology, applied in the field of crop genetics and breeding, can solve problems such as unclear biological regulation, and achieve the effect of increasing oil content, increasing oleic acid and linoleic acid content

Active Publication Date: 2021-04-13
HUAZHONG AGRI UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] All the genes related to lipid degradation known in plants are various enzymes (enzymes), but the biological regulation of the lipid degradation process is still unclear
However, there are no reports related to lipid regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ahl4 in regulating plant lipid metabolism and method for increasing plant seed oil content and unsaturated fatty acid content
  • Application of ahl4 in regulating plant lipid metabolism and method for increasing plant seed oil content and unsaturated fatty acid content
  • Application of ahl4 in regulating plant lipid metabolism and method for increasing plant seed oil content and unsaturated fatty acid content

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1AHL4 specifically binds unsaturated phosphatidic acid (PA)

[0035] In this example, AHL4 protein was specifically expressed in Escherichia coli, and purified using His antibody to obtain purified AHL4 protein. Then, the combination of AHL4 and different lipids was analyzed by using a membrane hybridization method (Filter-blotting assay).

[0036] 1. AHL4 protein is specifically expressed in Escherichia coli

[0037] In this example, the following sequence primers were used to clone the full-length CDS of AHL4 in the wild-type Arabidopsis (Col-0) cDNA library by high-fidelity enzymes. See SEQ ID NO.1 for Arabidopsis AHL4 CDS sequence.

[0038] AHL4-F:

[0039] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGAGAGAGAAGGAACT AACATCAA-3', see SEQ ID NO.3;

[0040] AHL4-R:

[0041] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTGCTTGGAACCTCGGTGTCAGATTCGCT ATG-3', see SEQ ID NO.4.

[0042] The PCR program and system The method and system refer to the method of Expression of Bras...

Embodiment 2

[0058] Example 2 AHL4 Knockout Mutants and Overexpression Plants Show Different Effects on Plant Seedling Establishment

[0059] In order to further study the function of AHL4 in plants, in this embodiment, 3 independent T-DNA insertion mutants (gene knockout mutants) of AHL4 were purchased at SALK Research Institute, and the method in Example 1 was used in the preparation The gene was overexpressed in A. thaliana, and a high abundance of AHL4 protein was detected by western blot.

[0060] In this embodiment, the above-mentioned materials are sown on 1 / 2MS sugar-free and 1% sucrose medium, and the germination rate of the seeds is detected, and the results are shown in figure 2 D and figure 2 E, where figure 2 The left figures of D and E are the data results on 1 / 2MS sugar-free medium; figure 2 The right panels of D and E show the data results on the medium containing 1% sucrose.

[0061] The results showed that the germination rate of the AHL4 mutants (ahl4-1 and ahl4-...

Embodiment 3

[0062] Example 3 AHL4 overexpression plants cannot effectively hydrolyze triacylglycerol (TAG) during seedling establishment

[0063] In order to further verify whether AHL4 affects the hydrolysis of TAG, in this example, the changes of TAG and PA content in seeds of AHL4 mutants and overexpressed plants in different periods on sugar-free and sugar-containing medium were measured. The method of TAG and PA content detection refers to the method of Overexpression of patatin-related phospholipase AIIIδaltered plant growth and increased seed oil content in camelina.Li et al. (2015).

[0064] The result is as image 3 shown, where image 3 The left graphs of A and B are the detection data on the sugar-free medium; image 3 The right panels of A and B show the detection data on the sugar-containing medium. The results showed that the TAG hydrolysis rate of the AHL4 mutant was significantly faster than that of the wild type on sugar-containing and sugar-free medium, while the over...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of crop genetics and breeding, and in particular relates to the application of AHL4 in regulating plant lipid metabolism and a method for increasing plant seed oil content and unsaturated fatty acid content. The research of the present invention found that AHL4 can specifically bind unsaturated phosphatidic acid, and found that AHL4 can regulate the establishment of plant seedling system; and speculate that the influence of AHL4 gene on the establishment of plant seedling system may be realized by regulating lipid metabolism. By comparing the rates of TAG hydrolysis in the seeds of AHL4 mutants and overexpressed plants, it was discovered and confirmed for the first time that AHL4 transcription factors can indeed affect plant lipid metabolism, and this conclusion was verified from the level of gene expression, providing mechanistic support at the gene level. The invention significantly increases the oil and unsaturated fatty acid content in plant seeds by overexpressing the AHL4 gene in plants.

Description

technical field [0001] The invention belongs to the technical field of crop genetics and breeding, and in particular relates to the application of AHL4 in regulating plant lipid metabolism and a method for increasing plant seed oil content and unsaturated fatty acid content. Background technique [0002] Plant seed germination and subsequent seedling establishment are crucial for the entire life cycle of plants. [0003] Lipids are mainly stored in the mature seeds of plants in the form of triacylglycerol (TAG: triacylglycerol). Lipids in mature seeds are the most important source of energy for plant seed germination and later seedling establishment before plants are able to photosynthesize. [0004] The degradation of oil in plants is regulated by complex biological processes. The main biological mechanisms of oil degradation in plants known at present include the following processes: (1) Oil is under the action of triacylglycerol lipase (TAG lipase) , degrade TAG into DA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/10A01H6/20
CPCC07K14/415C12N15/8247
Inventor蔡光勤王学敏周永明
OwnerHUAZHONG AGRI UNIV