Application of ahl4 in regulating plant lipid metabolism and method for increasing plant seed oil content and unsaturated fatty acid content
A plant seed, 1. AHL4 technology, applied in the field of crop genetics and breeding, can solve problems such as unclear biological regulation, and achieve the effect of increasing oil content, increasing oleic acid and linoleic acid content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1AHL4 specifically binds unsaturated phosphatidic acid (PA)
[0035] In this example, AHL4 protein was specifically expressed in Escherichia coli, and purified using His antibody to obtain purified AHL4 protein. Then, the combination of AHL4 and different lipids was analyzed by using a membrane hybridization method (Filter-blotting assay).
[0036] 1. AHL4 protein is specifically expressed in Escherichia coli
[0037] In this example, the following sequence primers were used to clone the full-length CDS of AHL4 in the wild-type Arabidopsis (Col-0) cDNA library by high-fidelity enzymes. See SEQ ID NO.1 for Arabidopsis AHL4 CDS sequence.
[0038] AHL4-F:
[0039] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGAGAGAGAAGGAACT AACATCAA-3', see SEQ ID NO.3;
[0040] AHL4-R:
[0041] 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTGCTTGGAACCTCGGTGTCAGATTCGCT ATG-3', see SEQ ID NO.4.
[0042] The PCR program and system The method and system refer to the method of Expression of Bras...
Embodiment 2
[0058] Example 2 AHL4 Knockout Mutants and Overexpression Plants Show Different Effects on Plant Seedling Establishment
[0059] In order to further study the function of AHL4 in plants, in this embodiment, 3 independent T-DNA insertion mutants (gene knockout mutants) of AHL4 were purchased at SALK Research Institute, and the method in Example 1 was used in the preparation The gene was overexpressed in A. thaliana, and a high abundance of AHL4 protein was detected by western blot.
[0060] In this embodiment, the above-mentioned materials are sown on 1 / 2MS sugar-free and 1% sucrose medium, and the germination rate of the seeds is detected, and the results are shown in figure 2 D and figure 2 E, where figure 2 The left figures of D and E are the data results on 1 / 2MS sugar-free medium; figure 2 The right panels of D and E show the data results on the medium containing 1% sucrose.
[0061] The results showed that the germination rate of the AHL4 mutants (ahl4-1 and ahl4-...
Embodiment 3
[0062] Example 3 AHL4 overexpression plants cannot effectively hydrolyze triacylglycerol (TAG) during seedling establishment
[0063] In order to further verify whether AHL4 affects the hydrolysis of TAG, in this example, the changes of TAG and PA content in seeds of AHL4 mutants and overexpressed plants in different periods on sugar-free and sugar-containing medium were measured. The method of TAG and PA content detection refers to the method of Overexpression of patatin-related phospholipase AIIIδaltered plant growth and increased seed oil content in camelina.Li et al. (2015).
[0064] The result is as image 3 shown, where image 3 The left graphs of A and B are the detection data on the sugar-free medium; image 3 The right panels of A and B show the detection data on the sugar-containing medium. The results showed that the TAG hydrolysis rate of the AHL4 mutant was significantly faster than that of the wild type on sugar-containing and sugar-free medium, while the over...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


