bcl2 mutant capable of promoting large gene expression and its application
A gene expression and mutant technology, applied in the field of genetic engineering, can solve the problems of low expression, affect recombinant protein, and insignificant expression effect, and achieve the effect of promoting expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: Point Mutation Bcl2
[0018] Mouse Bcl2 cDNA and human Bcl2 cDNA were cloned respectively between Nco I and Sal I of the pMigR1 plasmid, i.e. downstream of the internal ribosome entry site (IRES), see figure 1 . Using a point mutation kit (Transformer, CLONTECH), mutate the nucleotide G at position 568 (codon 577 for human Bcl2) to T, so that the glycine corresponding to position 190 (codon 193 for human Bcl2) The residue codon GGA was replaced with a stop codon TGA. The mutation point is verified by cDNA sequencing. After the verification is correct, the required gene sequence of the mutant Bcl2 (ΔBcl2) with 47 amino acid residues removed from the tail is obtained, and the plasmid containing the ΔBcl2 is pMigR1-ΔBcl2 (containing The plasmid of human ΔBcl2 is pMigR1-ΔhBcl2). Then by the same method, the T codon corresponding to the 69th threonine residue and the S codon of the serine residue at the 70th and 84th positions (the 87th position corresponding t...
Embodiment 2
[0019] Example 2: Construction of a bicistronic retroviral expression vector containing the above-mentioned point mutant mouse Bcl2 and a gene greater than 4.3kb
[0020] Take the pMigR1 plasmid for BglII / SalI digestion, and then use agarose gel electrophoresis to separate and purify the pMigR1 restriction fragment; synthesize 5'GATCTCTCGAGGCGGCCGCCAATTGG3' and 5'TCGACCAATTGGCGGCCGCCTCGAGA3', anneal and ligate with the pMigR1 restriction fragment for introduction Multi-cloning enzyme cutting site BglII-XhoI-NotI-MunI-SalI, after connecting, transform Escherichia coli JM109, carry out screening culture in agarose culture dish containing ampicillin, amplify and cultivate positive Escherichia coli clones, and then extract Purify the plasmid. Sequencing was then performed to verify whether the sequence was correct, and the pMigR1-△GFP plasmid was obtained after verification.
[0021] Using the pMigR1 plasmid as a template, the GFP gene was amplified by PCR, the BglII restriction ...
Embodiment 3
[0022] Example 3: Transfect HEK293 cells and express fusion gene GFP greater than 5kb
[0023] Take two six-well cell culture plates, and culture HEK293 cells derived from human embryonic kidney in nine wells. The specific medium is DMEM supplemented with 15% fetal bovine serum, 2mM L-glutamine, 100 units / ml penicillin, 100 Microgram / ml streptomycin (prepared medium is complete medium). Culture HEK293 cells in this medium and culture them in an incubator at 37°C with 5% carbon dioxide concentration. After the cells are 70-80% confluent in the culture dish, use DMEM containing only 5% fetal bovine serum The medium was washed twice, and then 2 ml of DMEM medium containing only 5% fetal bovine serum was added to each well, and placed in an incubator for use. Take the above-mentioned purified pMigR1-△Bcl2 EEE -GFP-BDD FVIII, pMigR1-Bcl2 EEE -GFP-BDD FVIII and pMigR1-Bcl2 WT -15 micrograms of GFP-BDD FVIII retrovirus expression vector plasmids were dissolved in 750 microliters ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


