Purification method of Pseudomonas aeruginosa vaccine recombinant protein reSBP
A technology of Pseudomonas aeruginosa and a purification method, which is applied in the field of purification of the recombinant protein reSBP of Pseudomonas aeruginosa vaccine, can solve the problems of inability to meet industrial application requirements, increase the cost of production auxiliary materials and operation steps, increase the cost of protein and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Synthesis and subcloning of genes
[0032] Introduce the Ndel restriction site at the 5' of the reSBP coding sequence, introduce the stop codon TGA and the Xhol restriction site at the 3', connect the sequence with the pET30a vector through the Ndel and Xhol restriction sites, and connect the connected sequence vector Transformed into Escherichia coli BL21 to obtain pET30a-reSBP / BL21.
[0033] The DNA sequence of reSBP was synthesized, and the connection between the sequence and pET30a was synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0034] The DNA sequence of reSBP is shown in SEQ ID NO:1:
[0035] GCCGAGTCCCTCACCGTCGCGGCCACCCCGGTGCCGCACGCGGAGATCCTCAACGTGGTCAA GCCGCTGCTGGCCAAGGAAGGCGTGGACCTGAAGATCAAGGAGTTCACCGACTACGTGCAGCCGAA CGTGCAGGTCTCGGAAAAGCGCCTGGACGCCAACTTCTTCCAGCACCAGCCGTACCTCGATGAGTT CAACAAGGCCAAGGGCACCGACCTGGTCGCCGTGACCGGCGTACACATCGAGCCGCTGGGCGCCTA CTCGAGCAAGTACAAGAAGCTCGACGAACTGCCTTCCGGCGCTACCGTGGTGATTCCCAACGACGC CACCAACGGCGGCCGCGCCCT...
Embodiment 2
[0042] Example 2 Purification of recombinant fusion protein reSBP
[0043] 1. Large-scale cultivation of pET30a-reSBP / BL21
[0044] Take 100 μL of pET30a-reSBP / BL21 bacterial solution stored in a refrigerator at 4°C and add it to 20 mL of LB medium containing Kan+ resistance for primary activation. After culturing at 200 rpm for 12 hours at 37°C, take 10 mL of the primary activated bacterial liquid and add it to 4000 mL Contains Kan + Perform secondary activation in resistant LB medium, culture at 37°C for 3-4 hours until OD600 is 0.6-0.8, add 200 μL IPTG (final concentration: 100 μM) and place in a shaker at 16°C overnight for induction, then centrifuge at 6000 rpm for 10 minutes to collect bacteria body.
[0045] 2. Autoclave, centrifuge
[0046] About 20g of bacteria was dissolved in PBS (10mM, pH7.0-7.5) buffer solution (take 1 bag of PBS dry powder (1L / bag) and add 1000ml of grade I water to dissolve completely), mix and suspend according to the weight:volume ratio of ...
Embodiment 3
[0061] Example 3: Immunization of Animals
[0062] 1) Fifteen SPF grade BALB / C female mice aged 6-8 weeks were divided into experimental group, adjuvant control group and negative control group, with 5 mice in each group, purchased from Beijing Huafukang Company.
[0063] 2) For the first immunization, dilute the reSBP antigen with PBS and add Al(OH) at a concentration of 1mg / mL 3 ; Use a No. 5 half-gauge needle to inject into the muscles of both thighs. The injection volume of each BALB / C mouse in the experimental group was 100 μL, containing 50 μg of reSBP and Al(OH) 3 100μg; the injection volume of each BALB / C mouse in the adjuvant control group was 100μL, containing Al(OH) 3 100μg; each BALB / C mouse in the negative control group was injected with 100μL PBS, without protein and Al(OH) 3 adjuvant.
[0064] 3) The second immunization, the second immunization was carried out on the 14th day, the immune components were the same as above, the injection amount of protein ant...
PUM
| Property | Measurement | Unit |
|---|---|---|
| purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


