Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of pertuzumab drug resistance mutation, detection kit and detection method

A technology of Pertuzumab and a kit, applied in the field of biomedicine, can solve the problems of high development cost, low sensitivity and high sensitivity, and achieve the effects of avoiding unreasonable application, reducing patient burden and easy operation.

Inactive Publication Date: 2020-05-01
ZHEJIANG UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

High-throughput sequencing has a long detection cycle and low sensitivity; digital PCR has strict requirements on experimental operations and expensive development costs; and ARMS-PCR, as a commonly used mutation detection method in clinical practice, is easy to operate and has high sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pertuzumab drug resistance mutation, detection kit and detection method
  • Application of pertuzumab drug resistance mutation, detection kit and detection method
  • Application of pertuzumab drug resistance mutation, detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1.1 Cancer somatic mutation analysis

[0036] Somatic mutation information from 33 cancer types was downloaded from the TCGA database (https: / / gdc.cancer.gov / , MC3) and the COSMIC database (https: / / cancer.sanger.ac.uk / cosmic, V89) . Using TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM / ) to identify missense mutations that change the amino acid properties of the extracellular region of HER2, and through the UniProt database (https: / / www.uniprot.org / ) Do a manual filter. Subsequently, statistical analysis was performed on the mutations obtained by screening using R software (https: / / www.r-project.org / ). The result is as figure 1 As shown, HER2 S310F is the most frequent HER2 extracellular region mutation in all cancer types. Among them, the incidence rate is about 5% (21 / 412) in bladder cancer, about 1.3% (6 / 440) in gastric cancer, and about 0.1% (1 / 986) in breast cancer.

[0037] 1.2 Molecular simulation analysis

[0038] The S310F mutation is located in the HER2 extr...

Embodiment 2

[0055] 2.1 Design of HER2 S310F mutation detection primers

[0056] According to the HER2 S310F mutation gene sequence, design specific mutation detection primers. Primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. HER2 S310F mutation detection primers are as follows:

[0057] Upstream primer: CCTTTCTACGGACGTGGGACT

[0058] Downstream primer: CTCGGGCACAGGGCTTG

[0059] The amplified fragment sequence is:

[0060] CCTTTCTACGGACGTGGGAT CC TGCACCCTCGTCTGCCCCCTGCACAACCAAGAGGTGACAGCAGAGGATGGAACACAGCGGTGTGAGAAGTGCAGCAAGCCCTGTGCCCGAG, the fragment size is 113 bp.

[0061] 2.2 Standard plasmid construction

[0062] The wild-type HER2 gene plasmid (pCMV3-HER2) was purchased from Beijing Yiqiao Shenzhou Company. Using the pCMV3-HER2 plasmid as a template, the S310F mutation was introduced by circular point mutation PCR to construct a S310F mutant HER2 gene plasmid. The point mutation primers are as follows:

[0063] Upstream primer: CGGACGTGGGAT T CTGCACCCTC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of pertuzumab drug resistance mutation, a detection kit and a detection method. On the basis of bioinformatics analysis, molecular simulation analysis, a flow affinity experiment and an in-vitro antitumor activity experiment prove that S310F is drug resistance mutation of pertuzumab. The invention relates to an application of HER2 protein S310F mutation or HER2gene coding with S310F mutant protein as a molecular marker in preparation of a kit for detecting the drug resistance of pertuzumab. The kit used for detecting the drug resistance of pertuzumab comprises: an antibody for detecting mutation of HER2 protein S310F, or a primer pair for detecting an HER2 gene encoding protein with mutation of S310F. The detection method of the drug-resistant mutationHER2S310F is established on the basis of an ARMS-PCR technology principle. The detection method can be used as a concomitant diagnosis scheme of pertuzumab treatment, is simple and convenient in operation and low in cost, and has great significance in clinically avoiding unreasonable application of pertuzumab and relieving the burden of a patient.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to the application, detection kit and detection method of Pertuzumab resistance mutation. Background technique [0002] HER2 protein belongs to the epidermal growth factor receptor family and is a transmembrane protein with tyrosine kinase activity. Can be divided into 4 sub-domains (I, II, III, IV). HER2 participates in regulating the proliferation, differentiation and survival of normal cells by activating different signaling pathways. However, its abnormal expression is closely related to the occurrence and development of various solid tumors, so it is considered an important target for tumor targeted therapy. Trastuzumab and Pertuzumab are monoclonal antibody drugs approved by the FDA for the treatment of HER2-positive tumors, and their clinical application has significantly improved the survival rate of patients with HER2-positive tumors. However, the problem of drug resi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6851G01N33/68G01N33/577G01N33/574
CPCC12Q1/6851C12Q1/6886C12Q2600/106C12Q2600/156G01N33/574G01N33/577G01N33/68C12Q2531/113C12Q2563/107
Inventor 张颖杨晓月周展陈枢青
Owner ZHEJIANG UNIV