Aspergillus awamori, its agent and its application
A technology of Aspergillus awamori and bacterial agent, which is applied in the field of Aspergillus awamori, bacterial agent and its application. It can solve problems that need to be studied, and achieve the effect of increasing the weight loss rate of straw, increasing the fermentation temperature, and good composting effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 strain isolation and screening
[0032] (1) Isolation of cellulase-producing strains: collect rotten straw and livestock manure in the test field of Sinochem Agriculture Linyi R&D Center, weigh 1g into 100ml sterile water, shake at 150rpm, 30°C for 30min, and then carry out gradient diluted to 10 4, select 3 gradients for coating, and each gradient has 3 parallels. After culturing in a 30°C incubator for 2 days, select strains with different colony forms to streak on the PDA medium, and observe the growth of the colonies regularly. Then, the plate streak method was used to purify the strains, and they were numbered and stored separately.
[0033] (2) Screening of cellulase-producing strains: Prepare PDA medium (adding sodium carboxymethyl cellulose) by plate hydrolysis circle method, transplant the strains isolated and preserved in (1) into the center of the plate with a toothpick, and keep at 30°C After incubating at constant temperature for 48 hours, absor...
Embodiment 2
[0048] Identification of embodiment 2 B-13 bacterial strain
[0049] (1) Microbiological characteristics: On PDA medium, the colony grows rapidly, is flat, has a powdery texture, dark brown surface, no exudate, and the opposite side of the colony is orange-yellow in varying degrees, with radial grooves, and the spores are spherical or Near spherical, diameter 3.5 ~ 5μm, rough wall.
[0050] (2) Molecular biological characteristics:
[0051] The ITS sequence of the strain is as follows, and the phylogenetic tree can be found in figure 1 . Thus, the strain was identified as Aspergillus awamori.
[0052] AACGGGAGGGCGGGTCTTTGGGCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGT...
Embodiment 3
[0053] The preparation of embodiment 3 microbial bacterial agents
[0054] Step 1: Inoculate the Aspergillus awamori B-13 strain and the bacterium cake preserved in the plate into an Erlenmeyer flask containing 250ml of PDA culture solution, and culture it in a constant temperature incubator at 30°C and 170rpm for 3 days.
[0055] Step 2: Inoculate the above-mentioned fermented bacteria liquid into a solid medium at a ratio of 5% (v / w), culture it at 28°C for three days, dry it and pulverize it, and mix it with wheat bran to form a viable count of 5 billion / g Aspergillus awamori B-13 bacterial powder, that is, the Aspergillus awamori B-13 bacterial agent for composting. The formula of the solid medium is: peat soil 25%, wheat bran 10%, soybean meal 15%, potato extract 20%, glucose 5‰, sodium chloride, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, calcium carbonate 1‰ each, replenish water to 100%, pH adjusted to 7.0.
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 

