Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene for encoding chalcone synthase of spatholobus suberectus and application of gene

A technology of chalcone synthase and chalcone synthase, which is applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of the endangered depletion of wild resources, and no cloning of chalcone synthase from the chalcone vine has been found. The effect of applying value

Active Publication Date: 2020-06-02
GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the medicinal materials of Caulis Spatholobus in the market are mainly derived from wild resources. Due to years of harvesting, China's wild resources are on the verge of depletion.
However, the cloning of the Milletanus chalcone synthase (SsCHS) gene and its application as a method for increasing the content of flavonoids in plants have not yet been found.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for encoding chalcone synthase of spatholobus suberectus and application of gene
  • Gene for encoding chalcone synthase of spatholobus suberectus and application of gene
  • Gene for encoding chalcone synthase of spatholobus suberectus and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] SsCHS gene cloning

[0033] (1) RNA and DNA extraction: Trizol reagent (Invitrogen, USA) was used to extract total RNA from fresh young leaves of Spatholobus spatholobi, and RNase Free DNase (Promega, USA) was used for pretreatment to eliminate genomic DNA contamination. The RNA integrity was analyzed with 1.5% agarose gel, and the purity and concentration of RNA were determined by spectrophotometry.

[0034] A plant DNA kit (TIANGEN) was used to extract total DNA from fresh young leaves of Spatholobus spatholobi.

[0035] (2) Gene cloning: Design primers based on the CHS sequence in the spatholobi genome, using DNA as a template and using Primer5.0 software to design gene-specific primers:

[0036] F1: CCCGTCCCTCATACCTACTCGC (SEQ ID NO: 4)

[0037] R1: AAGACATTCTCCTGCAACAC (SEQ ID NO: 5)

[0038] Through PCR amplification, a gDNA sequence with a length of 2025bp is obtained, such as SEQ ID NO:1.

Embodiment 2

[0040] SsCHS gene cloning

[0041] The RNA extracted in Example 1 was subjected to reverse transcription (AMV first strand cDNA synthesis kit: Roche, Switzerland), using the first strand cDNA as a template and using primers

[0042] F1: ATGGTGACCGTGGAGGAAATCCG (SEQ ID NO: 6)

[0043] R1: CCTTGGACCTCTTCCTCACC (SEQ ID NO: 7)

[0044] Through PCR amplification, a cDNA sequence SEQ ID NO: 2 with a length of 1063 bp was obtained.

Embodiment 3

[0046] After translation according to the cDNA sequence of Example 2, the amino acid sequence SEQ ID NO: 3 encoding the chalcone synthase (SsCHS) of spatholobi was obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene for encoding chalcone synthase of spatholobus suberectus and an application of the gene. The gene is obtained from the spatholobus suberectus for the first time, and theblank in separation and cloning of the chalcone synthase gene from a traditional Chinese medicinal material, spatholobus suberectus is filled up. The provided chalcone synthase gene has a nucleotidesequence shown in SEQ ID NO.1 or a homologous sequence of one or more added, replaced, inserted or deleted nucleotide or a nucleotide sequence of an allelic gen or a derivative. The gene encoded protein has an amino acid sequence shown in SEQ ID NO.3 or a homologous sequence of one or more added, replaced, inserted or deleted amino acid. The gene has expression in roots, stems, leaves, flowers andfruits of spatholobus suberectus and has higher expression in leaves and flowers. Application of the provided chalcone synthase gene and increase of the content of the flavonoid active ingredient inthe spatholobus suberectus have good application prospects in improvement of genetic resources of the spatholobus suberectus.

Description

Technical field [0001] The present invention relates to the field of biotechnology, and relates to key enzymes in the synthetic pathway of spatholobi flavonoids and their coding genes. More specifically, the present invention relates to genes encoding spatholobi chalcone synthase and their applications. Background technique [0002] Spatholobus suberectus Dunn is derived from the dried cane of the legume (Leguminosae) plant Spatholobus suberectus Dunn. It is a commonly used traditional Chinese medicine. It has a bitter, sweet taste and warm nature. It is attributed to the liver and kidney channels. It has the effects of nourishing blood and promoting blood circulation, regulating menstruation and relieving pain, and relaxing muscles and collaterals. It is used to treat irregular menstruation, dysmenorrhea, amenorrhea, rheumatic arthralgia, numbness, paralysis, blood deficiency and chlorosis, etc. It is widely used in gynecology, rheumatic arthralgia and other Chinese patent medic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/11C12N15/82A01H5/00A01H6/82
CPCC12N9/1037C12N15/8243C12Y203/01074
Inventor 秦双双缪剑华梁莹韦坤华李林轩
Owner GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS