Gene for encoding chalcone synthase of spatholobus suberectus and application of gene
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of chalcone synthase and chalcone synthase, which is applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of the endangered depletion of wild resources, and no cloning of chalcone synthase from the chalcone vine has been found. The effect of applying value
Active Publication Date: 2020-06-02
GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At present, the medicinal materials of Caulis Spatholobus in the market are mainly derived from wild resources. Due to years of harvesting, China's wild resources are on the verge of de
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0032] SsCHS gene cloning
[0033] (1) RNA and DNA extraction: Trizol reagent (Invitrogen, USA) was used to extract total RNA from fresh young leaves of Spatholobus spatholobi, and RNase Free DNase (Promega, USA) was used for pretreatment to eliminate genomic DNA contamination. The RNA integrity was analyzed with 1.5% agarose gel, and the purity and concentration of RNA were determined by spectrophotometry.
[0034] A plant DNA kit (TIANGEN) was used to extract total DNA from fresh young leaves of Spatholobus spatholobi.
[0035] (2) Gene cloning: Design primers based on the CHS sequence in the spatholobi genome, using DNA as a template and using Primer5.0 software to design gene-specific primers:
[0036] F1: CCCGTCCCTCATACCTACTCGC (SEQ ID NO: 4)
[0037] R1: AAGACATTCTCCTGCAACAC (SEQ ID NO: 5)
[0038] Through PCR amplification, a gDNA sequence with a length of 2025bp is obtained, such as SEQ ID NO:1.
Embodiment 2
[0040] SsCHS gene cloning
[0041] The RNA extracted in Example 1 was subjected to reverse transcription (AMV first strand cDNA synthesis kit: Roche, Switzerland), using the first strand cDNA as a template and using primers
[0042] F1: ATGGTGACCGTGGAGGAAATCCG (SEQ ID NO: 6)
[0043] R1: CCTTGGACCTCTTCCTCACC (SEQ ID NO: 7)
[0044] Through PCR amplification, a cDNA sequence SEQ ID NO: 2 with a length of 1063 bp was obtained.
Embodiment 3
[0046] After translation according to the cDNA sequence of Example 2, the amino acid sequence SEQ ID NO: 3 encoding the chalcone synthase (SsCHS) of spatholobi was obtained.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a gene for encoding chalcone synthase of spatholobus suberectus and an application of the gene. The gene is obtained from the spatholobus suberectus for the first time, and theblank in separation and cloning of the chalcone synthase gene from a traditional Chinese medicinal material, spatholobus suberectus is filled up. The provided chalcone synthase gene has a nucleotidesequence shown in SEQ ID NO.1 or a homologous sequence of one or more added, replaced, inserted or deleted nucleotide or a nucleotide sequence of an allelic gen or a derivative. The gene encoded protein has an amino acid sequence shown in SEQ ID NO.3 or a homologous sequence of one or more added, replaced, inserted or deleted amino acid. The gene has expression in roots, stems, leaves, flowers andfruits of spatholobus suberectus and has higher expression in leaves and flowers. Application of the provided chalcone synthase gene and increase of the content of the flavonoid active ingredient inthe spatholobus suberectus have good application prospects in improvement of genetic resources of the spatholobus suberectus.
Description
Technical field [0001] The present invention relates to the field of biotechnology, and relates to key enzymes in the synthetic pathway of spatholobi flavonoids and their coding genes. More specifically, the present invention relates to genes encoding spatholobi chalcone synthase and their applications. Background technique [0002] Spatholobus suberectus Dunn is derived from the dried cane of the legume (Leguminosae) plant Spatholobus suberectus Dunn. It is a commonly used traditional Chinese medicine. It has a bitter, sweet taste and warm nature. It is attributed to the liver and kidney channels. It has the effects of nourishing blood and promoting blood circulation, regulating menstruation and relieving pain, and relaxing muscles and collaterals. It is used to treat irregular menstruation, dysmenorrhea, amenorrhea, rheumatic arthralgia, numbness, paralysis, blood deficiency and chlorosis, etc. It is widely used in gynecology, rheumatic arthralgia and other Chinese patent medic...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more