Temperature-resistant phytase-producing strain and application thereof

A technology of phytase and engineering strains, applied in the direction of enzymes, microorganisms, hydrolase, etc., can solve the problems of low expression level of phytase, and the anti-protease properties cannot fully meet the requirements of feed processing, and achieve high enzyme activity level, resistance to hot effect

Active Publication Date: 2020-06-05
QINGDAO VLAND BIOTECH GRP +1
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the expression level of phytase in natural materials is low, and some biological characteristics of natural phytase (such as thermal stability, protease resistance, etc.) cannot fully meet the requirements of feed processing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1 Construction of a recombinant expression strain of thermostable phytase

[0014] The applicant obtained a high-temperature-resistant mutant phytase G3Phy by protein engineering technology, and its amino acid sequence is SED ID NO:1. According to the codon preference of Trichoderma, the applicant optimized the codon of the phytase G3 gene, and synthesized the nucleotide sequence encoding phytase G3 SED ID NO: 2 by General Biosystems (Anhui) Co., Ltd.

[0015] Using the synthesized nucleotide sequence as a template, the G3phy gene fragment is amplified by using primers G3Phy-F and G3Phy-R.

[0016] The PCR primer sequences are as follows:

[0017] G3Phy-F: GGCTCTAGACAGTCGGAGCCCGAGCTGAAGC;

[0018] G3Phy-R: ATAACGCGTTTAGAGCGAGCAGGCGGGGATT;

[0019] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 70 s, and after 30 cycles, incubation at 72°C for 10 min. T...

Embodiment 2

[0037] Example 2 Screening of Trichoderma reesei O11-G3phy uracil auxotrophs

[0038] Principle: 5-fluoroorotic acid can induce the loss of orotate nucleotide transferase or orotidine monophosphate decarboxylase in the uracil nucleotide synthesis pathway, so that 5-fluoroorotic acid cannot form toxic Substance 5-fluorouracil nucleotides, thereby producing resistance to 5-fluoroorotic acid, whose pyrimidine nucleotide nutrition can be supplemented by adding uracil to the medium, thus using 5-fluoroorotic acid to induce the formation of The uracil auxotrophic strain can grow in the medium containing 5-fluoroorotic acid and uracil; while the wild-type strain cannot grow in the medium containing 5-fluoroorotic acid because it does not have resistance to 5-fluoroorotic acid. Grow under acidic culture conditions. Therefore, 5-fluoroorotic acid is commonly used to screen for uracil-deficient mutants.

[0039] Screening method: the spores of the Trichoderma reesei O11-G3phy engineer...

Embodiment 3

[0041] Example 3 Knockout of Endot gene

[0042] Construction of Endot gene knockout plasmid: Trichoderma reesei ( Trichoderma reesei ) genome as a template, use primers EndotU-F, EndotU-R to amplify the upstream sequence of Endot gene, and use primers EndotD-F, EndotD-R to amplify the downstream sequence of Endot gene. The coding nucleotide sequence of the Endot gene is SEQ ID NO:3.

[0043] The PCR primer sequences are as follows:

[0044] Primer EndotU-F: TGGTCAAGTCGGTAAAGCTGT;

[0045] Primer EndotU-R: CCCTATAAGCTCGCCAAGGAA;

[0046] Primer EndotD-F: GTGCATGCTGGTCCCGCCTGG;

[0047] Primer EndotD-R: CACAGTAACCAAAACCAATAA;

[0048] The reaction conditions were as follows: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 seconds, renaturation at 56°C for 30 seconds, extension at 72°C for 90 seconds, and after 30 cycles, incubation at 72°C for 10 minutes. The results of agarose electrophoresis showed that the size of the upstream sequence EndotU was 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of microbiological engineering modification, and specifically provides a Trichoderma reesei mutant strain for highly producing temperature-resistant phytase and application of the Trichoderma reesei mutant strain. A preservation number of Trichoderma reesei is CCTCC NO:M2018836. The Trichoderma reesei mutant strain is capable of efficient recombinant expression of the phytase, the enzyme activity of the phytase in shake flask fermentation liquid reaches up to 1950U / ml and is increased by 54.5% than that before mutation, and the enzyme activity of the phytase in fermented supernate of a 20L tank reaches up to 16680U / ml and is increased by 49.8% than that of an original strain. The heat resistance of the phytase obtained from recombinant expression of the Trichoderma reesei mutant strain is remarkably increased, and the phytase has very high enzyme activity and can be widely applied to the feed production field.

Description

technical field [0001] The invention belongs to the technical field of microbial engineering transformation, and in particular relates to a temperature-resistant phytase production strain and application thereof. Background technique [0002] Phytase, namely Myo-inositol hexaphosphatephosphohydrotase, is a general term for a class of enzymes that catalyze the hydrolysis of phytic acid and phytate into inositol and phosphoric acid (or phosphate) (Huang Zunxi, 1999 , food and fermentation industry). Phytase has a special spatial structure, which can sequentially separate phosphorus in phytic acid molecules, degrade phytate into inorganic phosphorus and inositol, and release other nutrients bound by phytate. It can be widely used as a feed additive. At present, the effect of feeding monogastric animals with phytase has been verified. After adding phytase to the feed, the amount of inorganic phosphorus can be reduced by 5-70%, and the discharge of phosphorus in manure can be ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N9/16C12R1/885
CPCC12N9/16C12Y301/03008Y02P60/87
Inventor李瑞李玉强吴秀秀黄亦钧
OwnerQINGDAO VLAND BIOTECH GRP