Temperature-resistant phytase-producing strain and application thereof
A technology of phytase and engineering strains, applied in the direction of enzymes, microorganisms, hydrolase, etc., can solve the problems of low expression level of phytase, and the anti-protease properties cannot fully meet the requirements of feed processing, and achieve high enzyme activity level, resistance to hot effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0013] Example 1 Construction of a recombinant expression strain of thermostable phytase
[0014] The applicant obtained a high-temperature-resistant mutant phytase G3Phy by protein engineering technology, and its amino acid sequence is SED ID NO:1. According to the codon preference of Trichoderma, the applicant optimized the codon of the phytase G3 gene, and synthesized the nucleotide sequence encoding phytase G3 SED ID NO: 2 by General Biosystems (Anhui) Co., Ltd.
[0015] Using the synthesized nucleotide sequence as a template, the G3phy gene fragment is amplified by using primers G3Phy-F and G3Phy-R.
[0016] The PCR primer sequences are as follows:
[0017] G3Phy-F: GGCTCTAGACAGTCGGAGCCCGAGCTGAAGC;
[0018] G3Phy-R: ATAACGCGTTTAGAGCGAGCAGGCGGGGATT;
[0019] The reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 s, renaturation at 56°C for 30 s, extension at 72°C for 70 s, and after 30 cycles, incubation at 72°C for 10 min. T...
Embodiment 2
[0037] Example 2 Screening of Trichoderma reesei O11-G3phy uracil auxotrophs
[0038] Principle: 5-fluoroorotic acid can induce the loss of orotate nucleotide transferase or orotidine monophosphate decarboxylase in the uracil nucleotide synthesis pathway, so that 5-fluoroorotic acid cannot form toxic Substance 5-fluorouracil nucleotides, thereby producing resistance to 5-fluoroorotic acid, whose pyrimidine nucleotide nutrition can be supplemented by adding uracil to the medium, thus using 5-fluoroorotic acid to induce the formation of The uracil auxotrophic strain can grow in the medium containing 5-fluoroorotic acid and uracil; while the wild-type strain cannot grow in the medium containing 5-fluoroorotic acid because it does not have resistance to 5-fluoroorotic acid. Grow under acidic culture conditions. Therefore, 5-fluoroorotic acid is commonly used to screen for uracil-deficient mutants.
[0039] Screening method: the spores of the Trichoderma reesei O11-G3phy engineer...
Embodiment 3
[0041] Example 3 Knockout of Endot gene
[0042] Construction of Endot gene knockout plasmid: Trichoderma reesei ( Trichoderma reesei ) genome as a template, use primers EndotU-F, EndotU-R to amplify the upstream sequence of Endot gene, and use primers EndotD-F, EndotD-R to amplify the downstream sequence of Endot gene. The coding nucleotide sequence of the Endot gene is SEQ ID NO:3.
[0043] The PCR primer sequences are as follows:
[0044] Primer EndotU-F: TGGTCAAGTCGGTAAAGCTGT;
[0045] Primer EndotU-R: CCCTATAAGCTCGCCAAGGAA;
[0046] Primer EndotD-F: GTGCATGCTGGTCCCGCCTGG;
[0047] Primer EndotD-R: CACAGTAACCAAAACCAATAA;
[0048] The reaction conditions were as follows: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 seconds, renaturation at 56°C for 30 seconds, extension at 72°C for 90 seconds, and after 30 cycles, incubation at 72°C for 10 minutes. The results of agarose electrophoresis showed that the size of the upstream sequence EndotU was 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More