Kit for rapidly detecting novel coronavirus antibody based on mixed antigen
A coronavirus, mixed antigen technology, applied in the direction of viruses/phages, viruses, viral peptides, etc., can solve the problem of no specific treatment methods for diseases, and achieve the effects of effective control, high detection sensitivity, and simple operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] This embodiment provides a novel coronavirus rapid diagnostic kit, specifically prepared through the following steps:
[0038] 1. Expression and purification of COVID-19 nucleocapsid protein
[0039] 1-1. With the nucleotide sequence corresponding to the amino acid sequence of the COVID-19 nucleocapsid protein (i.e. N protein) as a template, design a forward primer whose nucleotide sequence is ATGTCTGATAATGGACCCCA, and a reverse primer whose nucleotide sequence is GGCCTGAGTTGAGTCAGC Direction primers; PCR amplification, double digestion of PCR products and vectors, and cloning into prokaryotic expression vectors, including but not limited to pET28a / pET22b / pET21b / pET32a / pET40 / pGex-6P-1 / pMal-c2x.
[0040]1-2. Transform the recombinant plasmid containing the nucleotide sequence of the COVID-19 nucleocapsid protein into E.coli BL21 or Rossetta strain, spread it on a plate containing ampicillin or kanamycin, and incubate at 37°C After 16 hours, pick a single colony and inoc...
Embodiment 2
[0055] The COVID-19 nucleocapsid protein antigen colloidal gold and the COVID-19 spike protein antigen colloidal gold prepared by the method in Example 1 were clinically verified.
[0056] Take 5 clinically confirmed cases of novel coronavirus pneumonia, 5 normal samples and 2 negative control samples for verification. The verification method is as follows:
[0057] The COVID-19 nucleocapsid protein antigen colloidal gold and spike protein antigen colloidal gold were respectively coated into 96-well plates, and the coating amount of each well was 0.2 μg / well. In addition, the COVID-19 nucleocapsid protein antigen colloidal gold and COVID-19 spike protein antigen colloidal gold were mixed and coated into a 96-well plate, and the COVID-19 nucleocapsid protein antigen colloidal gold and COVID-19 spike protein antigen Each antigen colloid was coated with 0.2 μg / well. Negative control wells were set up when coating.
[0058] Add 100 μL of the above-mentioned different types of sp...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com