A kind of method and application for gene editing of Agaricus bisporus
A Agaricus bisporus gene editing technology, applied in the field of gene editing systems, can solve the problems of Agaricus bisporus breeding restrictions, inability to obtain homozygotes, lack of endogenous expression promoters of Agaricus bisporus, etc., and achieve high editing efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Embodiment 1, Agaricus bisporus mycelia culture.
[0052] 1.1 Configuration of medium
[0053] The medium used in the present invention includes: improved PDA medium; minimal medium (MM); induction medium (IM); co-cultivation medium (CM); screening medium (MMP); Medium configuration:
[0054] Improved PDA medium: use an electronic balance to accurately weigh 2 g of yeast extract, 2 g of peptone, 0.5 g of magnesium sulfate, 1 g of dipotassium hydrogen phosphate, 0.46 g of potassium dihydrogen phosphate, 20 g of glucose, and 18 g of agar in a beaker, add water to 1 L and stir well.
[0055] Minimal medium (MM): Take 10 mL K-buffer [262 g / L dipotassium hydrogen phosphate, 145 g / L potassium dihydrogen phosphate (pH 7.0), 20 mL M-N (30 g / L magnesium sulfate, 15 g / L L sodium chloride), 1 mL 0.75% calcium chloride, 10 mL 21.8% glucose, 10 mL 0.018% ferrous sulfate, 5 mL trace elements (100 mg / L zinc sulfate, 100 mg / L copper sulfate, 100 mg / L Boric acid, 100 mg / L manganese ...
Embodiment 2
[0073] Embodiment 2, transcribing gRNA and expressing the vector construction of Cas9 protein
[0074] 2.1 Acquisition of human homologous U6 gene promoter
[0075] According to the coding sequence analysis of the Agaricus bisporus genome, the gene sequence homologous to the human U6 gene in Agaricus bisporus was obtained by BLAST comparison, and the only gene sequence of Agaricus bisporus homologous to the human U6 gene was found and named as AbU6 gene. Then the 500 bp sequence before its transcription start site was taken out as its promoter sequence, and named as P AbU6 , the sequence is shown in SEQ ID NO:1.
[0076] 2.2 Cloning of highly expressed U6 promoter of Agaricus bisporus
[0077] Primers are:
[0078] U6-F: GACCTGCAGGTACCCCGTGTATGATTGGTAC
[0079] U6-R: ACCGAGACCTCGGTCTCTCAATAGTTAACAGCGTGGATC
[0080] The PCR system is: high-fidelity enzyme 2 μL; primers 2 μL; water 35 μL; DNA template 2 μL; PCR buffer 5 μL; dNTP 2 μL.
[0081] The PCR reaction conditions...
Embodiment 3
[0131] Embodiment 3, Agaricus bisporus AbPPO4 Acquisition of positive hyphae transformed by gene mutation
[0132] 3.1 Acquisition of Agrobacterium:
[0133] 3.1.1. Preparation of Agrobacterium LBA4404 Competent Cells:
[0134] (1) Four Agrobacterium strains LBA4404 were taken, and cultured in a 28 C incubator for 30 hours after streaking. In order to ensure that there was no contamination by bacteria, a single colony was picked and cultured overnight.
[0135] (2) Take 10 μL as the seed and expand the culture until the OD600 is equal to 0.5 (about 27h).
[0136] (3) Put the bacterial solution in an ice bath for 30 min, pre-cool the centrifuge during this period, then centrifuge to remove the supernatant, and upside down on absorbent paper to absorb the culture solution.
[0137] (4) Use pre-cooled 25 mL, 0.1 mol / L CaCl 2 Resuspend the cells in the solution and place in ice bath for 20 min.
[0138] (5) Centrifuge at 4 C, 4000 rpm for 10 min, and discard the supernatant. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More