Recombinant vector containing African swine fever virus immunogenic protein, recombinant bacteria and application thereof

A technology of African swine fever virus and African swine fever, which is applied in the field of recombinant vectors containing the immunogenic protein of African swine fever virus, can solve the problems that the virus and the body will no longer be in contact, and achieve the effect of blocking virus infection

Active Publication Date: 2020-07-28
CHANGSHA LVYE BIOTECHNOLOGY CO LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Since there is no commercial vaccine against ASFV on the market, the safest, most economical, and most effective means of prevention and control is biosafety prevention and control. The principle of prevention and control is to block the contact between the virus and the body, but none of the existing methods can guarantee The virus and the body are no longer in contact

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector containing African swine fever virus immunogenic protein, recombinant bacteria and application thereof
  • Recombinant vector containing African swine fever virus immunogenic protein, recombinant bacteria and application thereof
  • Recombinant vector containing African swine fever virus immunogenic protein, recombinant bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Acquisition of African Swine Fever p72 and p54 Gene Sequences

[0044] The African swine fever p54 protein exists in the inner envelope of the virus particle. It is one of the main structural proteins and strong immunogenic proteins of ASFV, and participates in the adsorption and entry of the virus to target cells. According to the p72 and p54 gene sequences of African swine fever in China's Jilin strain in GenBank (P72: GenBank: MK189456.1; P54: GenBank: MK214679.1), the sequence was optimized, and the modified sequence was provided by Nanjing GenScript Biotechnology Co., Ltd. Whole gene synthesis, the base sequence is shown in SEQ ID NO.1 and SEQ ID NO.2.

Embodiment 2

[0046] Obtaining of recombinant expression vectors pVE5523-ASFV-p72 and pVE5523-ASFV-p54

[0047] 1 Materials and methods

[0048] 1.1 Materials and sources

[0049] Restriction enzymes SalI and EcoRV were purchased from NEB Company, and Taq enzyme, dNTP, DNA Marker DL2000, DL15000, Agarose Gel DNA Purification Kit, Mini BEST Plasmid Purification Kit were purchased from Dalian Bao Biological Company. The cloning vector pVE5523 was provided by Nanjing GenScript Biotechnology Co., Ltd.

[0050] 1.2 Test method

[0051] The small fragments of the cloning vector pVE5523 were digested with SalI / EcoRV, respectively, were ligated with the p72 and p54 gene fragments that had been digested with the same double enzymes, and the plasmids were extracted after electrotransformation and sent to Nanjing GenScript Biotechnology Co., Ltd. for sequencing verification.

[0052] 2 test results

[0053] Recombinant plasmid sequencing results: After gene sequencing, the recombinant plasmid was ...

Embodiment 3

[0055] Preparation and detection of expressing African swine fever p72 and p54 genes

[0056] 1 Materials and methods

[0057] 1.1 Materials and sources

[0058] Erythromycin (Emr) was purchased from Baird Biotechnology Co., Ltd.

[0059] 1.2 Test method

[0060] Electrotransformation of the target gene in Lactobacillus ATCC393 and screening of resistant strains: The electrotransformed Lactobacillus ATCC393 was spread on the MRS solid culture plate containing 5 μg / ml erythromycin, and cultured in a 30°C incubator for 72h. Pick the colony on the plate and inoculate it into the MRS liquid medium containing 5 μg / ml erythromycin, and culture it statically at 30°C for 72 hours; extract the plasmid in the bacteria, use fluorescent quantitative PCR to identify, identify primers and amplify the sequence as follows.

[0061] Detection of p72 fluorescent quantitative PCR:

[0062] p72 upstream primer (SEQ ID NO.3): AGTTCGGATGTCACAACGCTTG;

[0063] p72 downstream primer (SEQ ID NO....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a recombinant vector containing African swine fever virus immunogenic protein, recombinant bacteria and application thereof, and relates to the technical field of gene recombination. The recombinant vector can be used for constructing recombinant lactobacillus for expressing African swine fever virus immunogenic protein, and after lactobacillus bacterial solutions capable ofsecreting protein p72 and protein p54 respectively are mixed, an oral living bacterium preparation capable of being used for preventing African swine fever virus is prepared. The oral viable bacteriapreparation created by the invention can be used for safely, effectively and rapidly preventing the infection of the African swine fever virus to pigs, and does not contain an immunization process.

Description

technical field [0001] The invention belongs to the technical field of gene recombination, and in particular relates to a recombinant vector containing an African swine fever virus immunogenic protein, a recombinant bacterium and an application thereof. Background technique [0002] African swine fever (African swine fever virus, ASFV) is an acute, febrile, highly contagious zoonotic disease, its morbidity and mortality can be as high as 100%, and it is the number one killer of the pig industry. Currently, there is no commercial vaccine available. African swine fever virus is the only member of the African swine fever virus genus in the African swine fever family. The diameter of the virus particle is 175-215 nanometers, which is icosahedrally symmetrical and has a capsule; the genome is a double-stranded linear DNA with a size of 170-190 kb. [0003] African swine fever (ASFV) is a highly contagious infectious disease. It enters the pig body through the mouth and upper resp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N15/35C12N1/21A61K39/12A61P31/20C12R1/225
CPCC12N15/74C07K14/005A61K39/12A61P31/20C12N2710/12022C12N2710/12034A61K2039/523C12N15/746C12R2001/245C12N2800/101C12N2800/22A61K2039/542A61K2039/5256C12N15/00A61K35/747A61K2035/115C12N1/20C12N15/86C12N2710/12043C12N2710/12052C12N2710/12071
Inventor董伟谢小红文利新吴朝亮李鑫张永勇黄佳豪
OwnerCHANGSHA LVYE BIOTECHNOLOGY CO LTD