Supercharge Your Innovation With Domain-Expert AI Agents!

Specific DNA fragment SSM2 for sex determination of sturgeons and application

A specific, sturgeon technology, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microorganism determination/inspection, etc., can solve the problem of increasing the difficulty of sex-specific related genes or markers in sturgeon, and failing to detect sturgeon sex-specific Sexual DNA molecular markers and other issues, to achieve the effect of a wide range of applications and less damage to the fish body

Active Publication Date: 2020-07-31
YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF10 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Siberian sturgeon (A.baerii), Russian sturgeon (A.gueldenstaedtii), sterlet (A.ruthenus), Italian sturgeon (A.naccarii), lake sturgeon (A. Genome differences between male and female individuals of sturgeon (A.fulvescens), Persian sturgeon (A.percicus), European sturgeon (Huso huso), Schrenckii (A.schrenckii) and Chinese sturgeon (A.sinensis) were not detected. Sex-specific DNA molecular markers of fish (Wuertz et al., 2006; Keyvanshokooh et al., 2007; McCormick et al., 2008; Yarmohammadi et al., 2011; Liu Cui, 2011; Liu Xueqing et al., 2015)
This may be because the genomes of male and female sturgeons are slightly different; at the same time, it may also be because sturgeons, unlike higher bony fishes, have undergone multiple genome duplications during their evolution (Zhang Siming et al., 1999; Ludwig et al., 2001 ), its characteristics of polyploidy and large number of chromosomes increase the difficulty of identifying sex-specific related genes or markers in sturgeon

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific DNA fragment SSM2 for sex determination of sturgeons and application
  • Specific DNA fragment SSM2 for sex determination of sturgeons and application
  • Specific DNA fragment SSM2 for sex determination of sturgeons and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Obtaining the specific DNA fragment SSM2 for sex determination of sturgeon:

[0036] Using paraffin sections of gonad tissue to identify 20 male and female Sturgeon's sturgeons, extract their whole genome DNA, construct a sequencing library, and perform sequencing on the Illumina sequencing platform to obtain the whole genome sequencing data of male and female Sturgeon's sturgeons, which were obtained by comparative genomics analysis The female sex-specific DNA fragment, and corresponding primers were designed to verify its effectiveness in the population, and finally the female-specific DNA fragment SSM2 (shown in SEQ ID NO.1) was obtained, and no homologous sequence was found through GenBank database comparison.

Embodiment 2

[0038] The method of using the specific DNA fragment SSM2 for determining the sex of sturgeon:

[0039]1) Primers designed for the sequence shown in SEQ ID NO.1 are: F: ATACTATAACCCCTTTTACGC and R: TTCTTTTGGTTGCCCGAT.

[0040] 2) PCR amplification:

[0041] The reaction system is about 50ng of template DNA; 1.5U of Taq polymerase; 2.5μl of 10×amplification buffer; the concentration of four dNTPs is 200μM; the final concentration of upstream and downstream primers is 0.2μM; add ddH2O to 25μl.

[0042] The corresponding PCR reaction conditions were pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 25 s, and 35 cycles; final extension at 72°C for 7 min; storage at 4°C.

[0043] After PCR amplification, 2% agarose gel was prepared for electrophoresis detection. If the specific band was amplified, it was a female individual, and if no specific band was amplified, it was a male individual.

Embodiment 3

[0045] Application of specific DNA fragment SSM2 in sex identification of sturgeon:

[0046] 1) The fin ray tissue samples of 12 male and female individuals are known to be stored in absolute ethanol, and the genomic DNA is extracted by high-salt method, diluted to 50ng / μL and stored at -20°C for later use; the mentioned sturgeon is: Chinese Sturgeon, Acipenser dabryi, Acipenser schrenckii, Acipenser dabryi, Siberian sturgeon, Russian sturgeon, Acipenser schrenckii, Acipenser siberian (Acipenser ♀×Acipenser schrenckii), Acipenser dabryi (Acipenser dabryii ♀×Acipenser schrenckii ♂).

[0047] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned sturgeon DNA sample;

[0048] 3) The amplification results are as follows:

[0049] figure 1 Shows the amplification results of Sturgeon's sturgeon; in the figure 1-12, the male individuals cannot amplify the band, 13-24, the female individuals can amplify the 264bp specific band, C indicates the nega...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of fish sex determination in the field of aquaculture, and particularly relates to a specific DNA fragment SSM2 for sex determination of sturgeons and application. According to the invention, a specific DNA fragment of sturgeon female individuals is obtained through a high-throughput sequencing and genome comparison method. Primers are designed for the fragment,and can perform accurate and rapid sex identification on nine kinds of sturgeons. An identification method of the invention has the characteristics of simple, quick and accurate operation, extremely small damage to the sturgeons and the like, solves the problem of sturgeon sex identification, and is helpful for rapid development of the sturgeon culture industry.

Description

technical field [0001] The invention belongs to the field of fish sex identification in the field of aquaculture, and in particular relates to a specific DNA fragment SSM2 for sex identification of sturgeon and its application. Background technique [0002] Sturgeon parents take a long time to sexual maturity, and there are no obvious secondary sexual characteristics between male and female individuals. It is impossible to distinguish between male and female morphologically in the early stages of development. Usually, the identification of the sturgeon is carried out by abdominal surgery and other methods when the sturgeon is 3-5 years old ( Chen Xihua et al., 2004). Due to the inability to judge the sex of juveniles in a timely manner, it is impossible to carry out intensive breeding according to the sex of males and females or to raise or breed them in a certain sex ratio, which in turn affects the artificial breeding of sturgeons and the protection of wild sturgeon resour...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6879C12N15/11
CPCC12Q1/6879C12Q1/6888
Inventor 阮瑞李创举危起伟岳华梅叶欢杜浩刘志刚冯彤阮珏
Owner YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More