A DNA detection method based on CRISPR/Cas9 and its application

A detection method, DNA molecular technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., to achieve the effect of rapid DNA detection, wide application value, and avoiding nucleic acid hybridization and amplification

Active Publication Date: 2021-06-18
SOUTHEAST UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These studies show that the CRISPR system has great potential and advantages when it is used to develop nucleic acid detection technology, but there are still various nucleic acid amplification technologies that must be reverse-transcribed, in vitro transcribed, and PCR-amplified for DNA or RNA. , RPA amplification, LAMP amplification, asymmetric PCR amplification and other pre-amplification can be used for specific cleavage of various Cas proteins (Cas13a, Cas12a, Cas12b) and gRNA and non-specific cleavage of fluorescent reporter molecules (signal amplification ) detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A DNA detection method based on CRISPR/Cas9 and its application
  • A DNA detection method based on CRISPR/Cas9 and its application
  • A DNA detection method based on CRISPR/Cas9 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Detection of Escherichia coli T7 RNA polymerase with Beads-HCR CADD

[0056] 1.1. Experimental method:

[0057] 1.1.1. Preparation of sgRNA in vitro transcription template by PCR amplification method

[0058] Using the online sgRNA design software Chop-Chop ( http: / / chopchop.cbu.uib.no / ), using hg19 as the reference genome, design a pair of sgRNA for each DNA molecule to be tested, named sgRNAa and sgRNAb respectively, where sgRNAa is used to bind to the capture oligonucleotide (Capture 1c) immobilized on the surface of magnetic beads or microwell plates , sgRNAb is used to bind to the oligonucleotide that captures the reporter ( figure 1 A. Figure 10 A. Figure 12 A). According to the design results, PCR primers were synthesized for PCR amplification to prepare DNA templates for preparing sgRNA by in vitro transcription. In Example 1, a pair of sgRNAs (Table 1.1) were designed for the T7 RNA polymerase DNA to be tested, and then corresponding PCR primers (Tabl...

Embodiment 2

[0087] Detection of Mutant TERT Promoter DNA by Beads-HCR CADD

[0088] 2.1. Experimental method:

[0089] 2.1.1. Preparation of sgRNA in vitro transcription template by PCR amplification method

[0090] 1.1.1 with embodiment 1. The designed sgRNAs targeting mutant TERT promoter DNA are shown in Table 2.1. The primers for preparing sgRNA transcription templates by PCR are shown in Table 2.2.

[0091] Table 2.1, sgRNA targeting TERT promoter DNA (SEQ ID NO.36-37 in sequence)

[0092]

[0093] Table 2.2. PCR primers for preparing TERT promoter sgRNA in vitro transcription template

[0094] Primer name sequence (5'–3') F1, Ra, Rb, sgRa, sgRb Same as table 1.1 TERT-a-sgRNA-F2 GGACCGCGCTCCCCACGTGGGTTTTTAGAGCTAGAAATAGCAAG TERT-a-sgRNA-F3 TTCTAATACGACTCACTATAGGGACCGCGCTCCCCACGTGG TERT-b-sgRNA-F2 TCCCCGGCCCAGCCCCTTCCGTTTTAGAGCTAGAAATAGCAAG TERT-b-sgRNA-F3 TTCTAATACGACTCACTATAGTCCCCGGCCCAGCCCCTTCC

[0095] 2.1.2. Preparation of...

Embodiment 3

[0111] Detection of HPV DNA with Beads-HCR CADD

[0112] 3.1. Experimental method:

[0113] 3.1.1. Preparation of sgRNA in vitro transcription template by PCR amplification method

[0114] 1.1.1 with embodiment 1. The designed sgRNAs targeting 15 high-risk HPV (high-risk HPV, hrHPV) DNA are shown in Table 3.1. The primers for preparing sgRNA transcription templates by PCR are shown in Table 3.2.

[0115] Table 3.1. sgRNA targeting 15 kinds of hrHPV DNA. Identical list 1.

[0116] Table 3.2, PCR primers for preparing 15 kinds of hrHPV sgRNA in vitro transcription templates

[0117]

[0118]

[0119] 3.1.2. Preparation of sgRNA by in vitro transcription method

[0120] The preparation method is the same as 1.1.2 of Example 1.

[0121] The sgRNA prepared in Example 3 is used to detect HPV DNA, wherein the 5' end target DNA binding sequence of sgRNAa and sgRNAb is the same as the sequence SEQ ID NO.4-33 described in Table 1; the 3' end capture sequence of sgRNAa and s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA detection method based on CRISPR / Cas9 and its application. In the method, a DNA molecule to be detected is incubated with a pair of dCas9-sgRNA at room temperature to form a dCas9-sgRNA-DNA-dCas9-sgRNA complex, which can be reused The capture sequence on the sgRNA captures the complex to the surface of the solid-phase substrate and captures the signal reporter molecule to realize the detection of the target DNA molecule. The method of the present invention can quickly and simply realize the detection of DNA molecules down to femtomole level without performing complicated and time-consuming steps such as nucleic acid amplification and nucleic acid hybridization in traditional nucleic acid detection. The present invention successfully avoids key bottlenecks such as nucleic acid hybridization and amplification in the field of nucleic acid detection and typing, realizes visualized and ultra-sensitive rapid DNA detection, and has extremely wide application value in the field of nucleic acid detection.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular a CRISPR / Cas9-based DNA detection method and its application. Background technique [0002] DNA testing and genotyping have always been important for basic research, various testing and diagnostic applications. Therefore, DNA detection and genotyping technology has been widely concerned, thus promoting the development of this type of technology. To sum up, there are three main types of DNA testing and genotyping techniques that are widely used. The first are various techniques based on the polymerase chain reaction (PCR). PCR is the most commonly used DNA detection and genotyping technique. PCR-based DNA detection and genotyping mainly rely on the design of specific primers and multiplex PCR amplification. PCR detection can be achieved by traditional PCR (tPCR), quantitative PCR (qPCR) and recently developed digital PCR. Because of obvious advantages, such as real-time detection an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6816C12Q1/70C12Q1/6869C12Q1/10
CPCC12Q1/6816C12Q1/6869C12Q1/708C12Q2521/327C12Q2525/00C12Q2565/50
Inventor王进科徐新慧
OwnerSOUTHEAST UNIV