PCR reagent and kit for detecting beta-thalassemia

A thalassemia and kit technology, which is used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of affecting the test, taking a long time, and being easily contaminated, so as to improve the detection accuracy and save time and cost. , the effect of shortening the inspection time

Inactive Publication Date: 2020-08-28
深圳市星蝶科技有限公司
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Traditional detection methods for β-thalassemia include detection and analysis of blood routine parameters, erythrocyte osmotic fragility test, hemoglobin electrophoresis test, etc. These detection methods have low specificity and are prone to false negatives
With the development of biotechnology, some molecular diagnostic methods with high specificity have been born, such as TaqMan probe technology, oligonucleotide probe hybridization, denaturing high performance liquid chromatography technology, multiple ligase-dependent probe amplification technology, Gene chips, etc., but these technologies need to extract DNA from peripheral blood, villi, and amniotic fluid. The quality of DNA is a very critical factor for the success of PCR, which directly affects subsequent experiments.
However, DNA is easily contaminated during extraction and purification, making the test results prone to false negatives or false positives, and the extraction and purification of DNA takes about 1-2 hours, and the detection process takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR reagent and kit for detecting beta-thalassemia
  • PCR reagent and kit for detecting beta-thalassemia
  • PCR reagent and kit for detecting beta-thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Preparation of nucleic acid hybridization membrane strips for detection of β-thalassemia

[0044] 1. Preparation of probes

[0045] Synthesize the β globin gene mutation probe according to the sequence in Table 2. The probe with the reverse complementary sequence has the same effect as the sequence in the table, and will not be listed one by one in this table. Synthesize β according to the sequence in Table 3. Table 3 shows the corresponding relationship between the globin gene normal probe, the beta globin gene normal probe and the beta globin gene mutation probe. In this embodiment, N represents the normal type, and M represents the mutant type. Amino labeling the 5' end or 3' end of the probe has the same effect. In this example, for the sake of uniformity and convenience, all probes are labeled with the 5' amino group. The synthesis method is a conventional DNA synthesis method.

[0046] Table 2 DNA sequences of β globin gene mutation probes

[0047] ...

Embodiment 2

[0055] Embodiment 2 is used to amplify the design of the PCR primer of beta globin gene in the sample to be detected

[0056] Search the β globin gene nucleotide sequence (GenBank: AH001475.2) from NCBI, and according to the primer design principle, use two pairs of specificity, different length and Tm value, and contain biotin-labeled PCR at the 5' end Primers amplify two fragments of the beta globin gene. The nucleotide sequences of these two pairs of primers are shown in Table 5, wherein the amplified products of SEQ ID NO.3 and SEQ ID NO.4 can be hybridized with 654N and / or 654M probes for detecting 654 site mutations, SEQ ID The amplified products of NO.1 and SEQ ID NO.2 were used to detect mutations at other sites except 654.

[0057] Table 5 DNA sequences of PCR primers of different lengths of β-globin gene fragments

[0058] serial number Primer name Sequence (5'-3') SEQ ID NO.1 Left-Primer-F GTACGGCTGTCATCACTTAGACCTCCA SEQ ID NO.2 Left-...

Embodiment 3

[0059] The PCR amplification of the sample to be detected in embodiment 3

[0060] Whole blood samples were amplified by PCR with omniTaq enzyme (purchased from VitaNaviTechnology, USA), and at the same time, genomic DNA in whole blood was extracted according to conventional methods and sample DNA was amplified with common Taq enzyme as a control. Wild-type DNA was used as a template to amplify as a positive control, and sterile water as a template to amplify as a negative control. The amplification system is shown in Table 6, and the amplification conditions are shown in Table 7. After the amplification was completed, 5uL were taken for 1% agarose gel electrophoresis, and the results were as follows: figure 1 As shown, wherein No. 1-5 swimming lanes are the electrophoresis results after genomic DNA extraction and purification by traditional methods and then PCR amplification, and No. 6-10 swimming lanes are the corresponding PCR reagents provided by the present invention aft...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PCR reagent and kit for detecting beta-thalassemia. According to the PCR reagent, a whole blood sample for beta-thalassemia detection is amplified by adopting a high-tolerancedirect spreading PCR enzyme; and a genome DNA in the sample does not need to be extracted. According to the detection kit obtained by using the PCR reagent, the whole detection time of detection personnel is shortened, and the time cost is greatly saved; and meanwhile, DNA extraction and purification processes are reduced, so that the factors of influencing the detection accuracy are reduced, andthe accuracy of the detection result is greatly improved.

Description

technical field [0001] The invention relates to the field of biomedical diagnosis, in particular to a PCR reagent and a kit for detecting beta-thalassemia. Background technique [0002] β-thalassemia is caused by reduced or deficient synthesis of β-globin in the tetrameric form of hemoglobin and is classified according to clinical symptoms and hematological features: β-thalassemia carrier status, thalassemia intermedia, and thalassemia major. The carrier state of β-thalassemia results from heterozygosity for β-thalassemia, is clinically asymptomatic, and is defined by specific hematologic features. Thalassemia major is a severe transfusion-dependent anemia, and thalassemia intermedia ranges in severity from asymptomatic carrier status to severe transfusion-dependent anemia types. [0003] β-Thalassemia is heterogeneous at the molecular level. To date, more than 200 pathogenic mutations have been identified. Most mutations are single nucleotide substitutions, deletions or ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883
Inventor艾卉钱凯谭毅彬朱韶凯
Owner深圳市星蝶科技有限公司