PCR reagent and kit for detecting beta-thalassemia
A thalassemia and kit technology, which is used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of affecting the test, taking a long time, and being easily contaminated, so as to improve the detection accuracy and save time and cost. , the effect of shortening the inspection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Preparation of nucleic acid hybridization membrane strips for detection of β-thalassemia
[0044] 1. Preparation of probes
[0045] Synthesize the β globin gene mutation probe according to the sequence in Table 2. The probe with the reverse complementary sequence has the same effect as the sequence in the table, and will not be listed one by one in this table. Synthesize β according to the sequence in Table 3. Table 3 shows the corresponding relationship between the globin gene normal probe, the beta globin gene normal probe and the beta globin gene mutation probe. In this embodiment, N represents the normal type, and M represents the mutant type. Amino labeling the 5' end or 3' end of the probe has the same effect. In this example, for the sake of uniformity and convenience, all probes are labeled with the 5' amino group. The synthesis method is a conventional DNA synthesis method.
[0046] Table 2 DNA sequences of β globin gene mutation probes
[0047] ...
Embodiment 2
[0055] Embodiment 2 is used to amplify the design of the PCR primer of beta globin gene in the sample to be detected
[0056] Search the β globin gene nucleotide sequence (GenBank: AH001475.2) from NCBI, and according to the primer design principle, use two pairs of specificity, different length and Tm value, and contain biotin-labeled PCR at the 5' end Primers amplify two fragments of the beta globin gene. The nucleotide sequences of these two pairs of primers are shown in Table 5, wherein the amplified products of SEQ ID NO.3 and SEQ ID NO.4 can be hybridized with 654N and / or 654M probes for detecting 654 site mutations, SEQ ID The amplified products of NO.1 and SEQ ID NO.2 were used to detect mutations at other sites except 654.
[0057] Table 5 DNA sequences of PCR primers of different lengths of β-globin gene fragments
[0058] serial number Primer name Sequence (5'-3') SEQ ID NO.1 Left-Primer-F GTACGGCTGTCATCACTTAGACCTCCA SEQ ID NO.2 Left-...
Embodiment 3
[0059] The PCR amplification of the sample to be detected in embodiment 3
[0060] Whole blood samples were amplified by PCR with omniTaq enzyme (purchased from VitaNaviTechnology, USA), and at the same time, genomic DNA in whole blood was extracted according to conventional methods and sample DNA was amplified with common Taq enzyme as a control. Wild-type DNA was used as a template to amplify as a positive control, and sterile water as a template to amplify as a negative control. The amplification system is shown in Table 6, and the amplification conditions are shown in Table 7. After the amplification was completed, 5uL were taken for 1% agarose gel electrophoresis, and the results were as follows: figure 1 As shown, wherein No. 1-5 swimming lanes are the electrophoresis results after genomic DNA extraction and purification by traditional methods and then PCR amplification, and No. 6-10 swimming lanes are the corresponding PCR reagents provided by the present invention aft...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


