Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific primer pair, probe and kit for detecting novel coronavirus

A detection kit and coronavirus technology, applied in the field of probes, detection kits, and specific primer pairs, can solve the problems of complicated machine setup and operation, high price, and high equipment maintenance costs.

Pending Publication Date: 2020-10-20
SUZHOU GENDX BIOTECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the methods for detection and identification of new coronaviruses are very limited. Fluorescence quantitative PCR technology is an important detection method for virus diagnosis, but real-time fluorescent quantitative PCR needs to be equipped with expensive fluorescent quantitative PCR instruments, and the maintenance cost of equipment is high, and the machine setting and operation are complicated. Professionals are required, so it is difficult to be fully promoted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair, probe and kit for detecting novel coronavirus
  • Specific primer pair, probe and kit for detecting novel coronavirus
  • Specific primer pair, probe and kit for detecting novel coronavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] The synthetic plasmid containing the S gene sequence of the new coronavirus is used as the detection target.

[0063] The upstream primer sequence is: 5'-CTCGGCTTTAGAACCATTGGTAGATTTGCCA-3' (Seq ID NO: 1);

[0064] The downstream primer sequence is: 5'- GTGCACAGTCTACAGCATCTGTAATGGTTC-3' (Seq ID NO: 2);

[0065] Probe: 5'-CTTGCTTTACATAGAAGTTATTTGACTCC(FAM-dT)(THF)G(BHQ1-dT)GATTCTTTCTTCAGG-3'(C3-SPACER);

[0066] The nucleic acid sequence of the probe is CTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGT (SEQ ID NO: 9).

[0067] Use the recombinant enzyme polymerase amplification (combined with exonuclease III) method to amplify the reaction system for amplification, and construct a 25 μl amplification reaction system as follows:

[0068] 30mM Tris-Acetate Buffer pH8.0

[0069] 100mM potassium acetate

[0070] 14mM magnesium acetate

[0071] 3mM Dithiothreitol

[0072] 5% polyethylene glycol (molecular weight 20000)

[0073] 2mM ATP

[0074] 20mM creatine phosphate ...

Embodiment 2

[0091] Taking the synthesized plasmid containing the S gene sequence of the new coronavirus as the detection target, select the following primer and probe sequences:

[0092] The upstream primer sequence is: 5'-TGCCAATAGGTATTAACATCACTAGGTTT-3' (SEQ ID NO: 3);

[0093] The downstream primer sequence is: 5'-TCTGAGAGAGGGTCAAGTGCACAGTCTAC-3' (SEQ ID NO: 4);

[0094] Probe: 5'-CTTGCTTTACATAGAAGTTATTTGACTCC (FAM-dT)(THF)G(BHQ1-dT)GATTTCTTCTTCAGG-3'(C3-SPACER).

[0095] By synthesizing a plasmid containing the S gene sequence of the new coronavirus as the detection target, carry out the method version amplification test of recombinase polymerase amplification (combined with endonuclease III), and construct a 50 μl amplification reaction system as follows:

[0096] 60mM tris-acetate buffer pH8.0

[0097] 100mM potassium acetate

[0098] 14mM magnesium acetate

[0099] 3mM Dithiothreitol

[0100] 5% polyethylene glycol (20000)

[0101] 2mM ATP

[0102] 20mM creatine phosphate

...

Embodiment 3

[0118] Select the primer pair and probe sequence designed in Example 2, and use the recombinase polymerase amplification (combined with endonuclease IV) method to amplify the reaction system for amplification, and construct a 50 μl amplification reaction system as follows:

[0119] 60mM tris-acetate buffer pH8.0

[0120] 100mM potassium acetate

[0121] 14mM magnesium acetate

[0122] 3mM Dithiothreitol

[0123] 5% polyethylene glycol (molecular weight 20000)

[0124] 2mM ATP

[0125] 20mM creatine phosphate

[0126] 100ng / μl creatine kinase

[0127] 400ng / μl E. coli recA protein

[0128] 200ng / μl E. coli SSB protein

[0129] 60ng / μl E. coli recO protein

[0130] 40ng / μl E. coli recR protein

[0131] 60ng / μl E. coli recF protein

[0132] 8Units Bacillus subtilis DNA polymerase I

[0133] 50ng / μl Endonuclease IV

[0134] 200U reverse transcriptase

[0135] 450 μM dNTPs

[0136] 420nM per upstream primer

[0137] 420nM each downstream primer

[0138] 120nM fluore...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a specific primer pair, probe and kit for detecting novel coronavirus. An S gene in the novel coronavirus is taken as a detection target, and a specific primer and probe combination is used through an isothermal amplification technology, so that the detection convenience and specificity of the novel coronavirus type are improved, and meanwhile, the detection time is greatlyshortened. Compared with a PCR detection method, a method disclosed by the invention has the advantages that a product electrophoresis verification process is omitted, a false positive result is avoided, and the detection accuracy is improved. Compared with qPCR, the method disclosed by the invention is simple, convenient and feasible, complex instruments and equipment do not need to be operated,the cost is saved, the detection efficiency is improved, and meanwhile, the method is convenient to popularize and use in a large range. Compared with other isothermal amplification methods, the detection method disclosed by the invention is shorter in required time and higher in detection accuracy.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to specific primer pairs, probes and detection kits for detecting novel coronaviruses. Background technique [0002] At present, real-time fluorescent quantitative polymerase chain reaction (qPCR) is an important means for screening and diagnosing new coronaviruses. This technology was originally a new nucleic acid quantitative test technology introduced by Applied Biosystems of the United States in 1996. Fluorescence quantitative PCR is based on conventional PCR by adding fluorescent probes or corresponding fluorescent dyes to achieve real-time quantification. As the PCR reaction proceeds, the PCR reaction products continue to accumulate, and the fluorescence signal intensity also increases proportionally. After each cycle, the fluorescence signal is collected, so that the change of the product amount can be monitored through the change of the fluorescence intensity, so as to obtain a f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2600/166C12Q2531/119C12Q2521/507C12Q2522/101C12Q2537/1376C12Q2563/107C12Q2545/113Y02A50/30
Inventor 高山珊陈文柱姚永豪于继彬
Owner SUZHOU GENDX BIOTECH CO LTD