Specific SS-COI primer pair of hypothenemus hampei Ferrari, identification kit and rapid identification method

A technology of coffee cherries and primer pairs, which is applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as money-consuming, time-consuming and labor-intensive, and unfavorable insect invasion and diffusion dynamics.

Active Publication Date: 2020-10-27

SPICE & BEVERAGE RES INST CHINESE ACAD OF TROPICAL AGRI SCI

6 Cites 1 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0004] Traditionally, the species identification of the coffee berry beetle mainly relies on external morphological characteristics. Since closely related species often appear in the same habitat, insect taxonomy professionals and microscopic equipment are needed to identify them. There are problems such as difficulty in identification and time-consuming. It is not conducive to mastering the dynamics of the insect's invasion and spread; and for samples such as eggs, larvae, pupae, and characteristic shedding residues, it cannot be identified by morphological characteristics

Therefore, in the process of quarantine and monitoring, traditional morphological identification methods can no longer meet the actual work needs

[0005] In recent years, with the development and wide application of molecular biology techniques, the molecular identification technology based on mitochondrial DNA cytochrome c ...

Abstract

The invention relates to the technical field of biology, in particular to a specific SS-COI primer pair of hypothenemus hampei Ferrari, an identification kit and a rapid identification method. The specific SS-COI primer pair consists of a forward primer as shown by SEQ ID NO:1 and a reverse primer as shown by SEQ ID NO:2. The specific SS-COI primers and method of the invention realize rapid molecular identification of the hypothenemus hampei Ferrari; the method is simple, is easy to operate, consumes short time; and the identification range is wide and the sensitivity is high.

Application Domain

Microbiological testing/measurementDNA/RNA fragmentation

Technology Topic

Molecular biologyForward primer +7

Image

Examples

Experimental program(6)
Comparison scheme(1)

Example Embodiment

[0046] Example 1: Extraction of insect genomic DNA

[0047] Genomic DNA extraction uses the Ezup Column Animal Genomic DNA Extraction Kit from Shenggong Bioengineering Co., Ltd. The specific steps are as follows:

[0048] (1) Wash the single-headed beetle with absolute ethanol for 5 seconds, then wash it with sterile water 5 times, and place it on sterile filter paper to dry;

[0049] (2) Put the dried beetle into a 1.5mL centrifuge tube, add 180μL of BufferACL, grind the sample thoroughly with an electric grinder, then add 20μL of Proteinnase K solution, shake and mix, and bath at 56℃ for 1h until the cells are completely lysed ;

[0050] (3) Add 200μL Buffer CL and mix thoroughly by inverting;

[0051] (4) Add 200μL of absolute ethanol and mix thoroughly by inverting;

[0052] (5) Put the adsorption column into the collection tube, use a pipette to add the solution and translucent fibrous suspension to the adsorption column, let it stand for 2 minutes, centrifuge at 10,000 rpm for 1 minute at room temperature, and discard the waste liquid in the collection tube;

[0053] (6) Put the adsorption column back into the collection tube, add 500 μL CW1 Solution to the adsorption column, centrifuge at 10,000 rpm for 30 seconds, and discard the collection tube waste;

[0054] (7) Put the adsorption column back into the collection tube, add 500μL CW2 Solution to the adsorption column, centrifuge at 10,000rpm for 30s, discard the waste liquid from the collection tube, put the adsorption column back into the collection tube, centrifuge at 12,000rpm for 2min at room temperature, Remove the remaining CW2 Solution (open the lid of the adsorption column, leave it at room temperature for a few minutes, and let it dry completely);

[0055] (8) Take out the adsorption column, put it into a new 1.5mL centrifuge tube, add 50μL CE Buffer and let it stand for 3min, centrifuge at 12,000rpm for 2min at room temperature, collect the DNA solution and store at -20℃.

Example Embodiment

[0056] Example 2: PCR amplification of COI gene of bark beetles

[0057] According to Jordal et al. (2011), S1718/A2237 was selected as the universal primer for the COI gene amplification of bark beetles:

[0058] S1718: 5’-GGAGGATTTGGAAATTGATTAGTTCC-3’

[0059] A2237: 5’-CCGAATGCTTCTTTTTTACCTCTTTCTTG-3’

[0060] Use Tiangen 2×Taq PCR MasterMixⅡ kit for PCR amplification reaction, total reaction system 25μL, including:

[0061]

[0062] Amplification conditions: 94°C pre-denaturation for 4min; 94°C denaturation for 30s, 46°C annealing for 50s, 72°C extension for 1min, 40 cycles; 72°C extension for 10min.

[0063] Take 5μL of the PCR product, electrophoresis it on a 1.2% agarose gel containing Gel stain for 20min (140V), detect the result with a gel imaging system, and take a picture.

[0064] The results showed that: this study amplified the COI gene fragments of 13 species of bark beetles and other insects, with a fragment size of about 520 bp. The 13 PCR products were directly sent to Shenggong Biological Engineering Co., Ltd. for bidirectional base sequence determination ( figure 1 ).

Example Embodiment

[0065] Example 3: Design of specific primers for the COI gene of Coffea berry

[0066] The COI sequences of 13 species of bark beetles (including coffee cherry) obtained in this study were verified by Blast sequence alignment in NCBI, and the results showed that the common primer S1718/A2237 was used to successfully amplify the COI fragments of 13 species of bark beetles. Then 13 COIs were subjected to multiple sequence alignment analysis, and 1 pair of COI-specific primers (SEQ ID NO: 1, SEQ ID NO: 2) of coffee cherry beetle were designed using the PrimerSelect software in DNASTAR:

[0067] HHTYF1: AAGGTGTTGATATAGGATTGGGTCC

[0068] HHTYR3: CCACTAATACTAGGCGCACCTG

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.