Method for efficiently expressing and secreting human growth hormone by utilizing escherichia coli
A technology of human growth hormone and Escherichia coli, which is applied in the field of genetic engineering, can solve problems such as allergic reactions, scarce yield, and long yeast expression cycle, and achieve the effects of efficient secretion and expression, increased expression, and easy promotion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The present invention will be further described below in conjunction with the examples, but the present invention is not limited to the following examples.
[0031] Escherichia coli heat-stable enterotoxin Ⅱ signal peptide coding sequence SEQ ID NO: 1
[0032] ATGAAGAAAAACATCGCGTTCCTGCTGGCGAGCATGTTCGTTTTTAGCATCGCGACCAACGCGTATGCG
[0033] The coding sequence of hGH is SEQ ID NO: 2
[0034] TTCCCGACCATTCCGCTGAGCCGTCTGTTTGACAACGCGATGCTGCGTGCGCACCGTCTGCACCAGCTGGCGTTCGATACCTACCAAGAGTTTGAGGAAGCGTATATCCCGAAGGAACAGAAATACAGCTTCCTGCAGAACCCGCAAACCAGCCTGTGCTTTAGCGAGAGCATTCCGACCCCGAGCAACCGTGAGGAAACCCAGCAAAAGAGCAACCTGGAGCTGCTGCGTATCAGCCTGCTGCTGATTCAGAGCTGGCTGGAACCGGTGCAATTCCTGCGTAGCGTTTTTGCGAACAGCCTGGTGTATGGCGCGAGCGACAGCAACGTTTACGACCTGCTGAAGGATCTGGAGGAAGGTATCCAGACCCTGATGGGTCGTCTGGAAGACGGCAGCCCGCGTACCGGTCAGATTTTCAAGCAAACCTACAGCAAATTTGATACCAACAGCCACAACGACGATGCGCTGCTGAAAAACTACGGCCTGCTGTATTGCTTCCGTAAGGACATGGATAAAGTGGAGACCTTTCTGCGTATTGTGCAATGCCGTAGCGTTGAAGGTAGCTGCGGCTTTTAA
[0035] Add t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



