Specific human gene fragment and primer probe and application thereof
A gene fragment, primer probe technology, applied in the field of molecular biological detection, can solve the problems of inability to specifically detect a variety of animal and human genes, lack of specificity of target genes, and inability to directly correspond to cell volume, etc., to reduce costs and operation. Simple, time-saving effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Human Gene Detection Kit
[0049] 1. Human cell-specific gene fragments: through the NCBI website and its BLAST sequence comparison function, determine the species specificity of the FOXP2 gene, and select the fragment with the highest specificity as the specific gene for the quantitative detection of human cell in the present invention fragment.
[0050] Specific gene fragment sequence of human cells (SEQID NO: 1):
[0051] TGCTATGTGATGGACATGGTTCTGTTTTAGTATTCATTGCATTTATAAGTACCAATATGCCAGAGTGGTAGTCTGGAACACCGTAAGAGTACTGGTGGGCTAAAAGGAAGAAAGAGGTCAAAAAGATAGATGGGGTACCTAAAGCCTGCCATATGTTTTCATCACT.
[0052] 2. Design specific primers and probes according to the specific gene fragment sequence of human cells, the sequence is as follows:
[0053] homo4-F (SEQ ID NO: 2): 5'-TGGTAGTCTGGAACACCGTAAGAGT-3';
[0054] homo4-R (SEQ ID NO: 3): 5'-CATATGGCAGGCTTTAGGTACCC-3';
[0055] homo4-P (SEQ ID NO: 4):
[0056] FAM-CTGGTGGGCTAAAAGGAAGAAAGAGGTC-TRAMA.
[0057] The primer...
Embodiment 2
[0058] Example 2 Standard plasmid construction
[0059] 1. Acquisition of human cell-specific gene fragments
[0060] Genomic DNA in human whole blood was extracted using a commercial genome extraction kit (blood / tissue / cell genomic DNA extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP304), and used as amplified human cell-specific gene fragment Added templates. Prepare the reaction system as follows:
[0061] Table 1 PCR reaction system
[0062] Reagent name Volume (μL) template 5 homo4-PF1 1 homo4-PR1 1 Premix Ex Taq Hot Start Version 10 Deionized water to 20
[0063] Among them, the primer homo4-PF1 (SEQ ID NO: 5): 5'-TGCTATGTGATGGACATGGTTCT-3'; homo4-PR1 (SEQ ID NO: 6): 5'-AGTGATGAAAACATATGGCAGGC-3'.
[0064] Reaction conditions: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 20 sec, renaturation at 55°C for 20 sec, extension at 72°C for 1 min, 30 cycles; final extension at 72°C ...
Embodiment 3
[0085] Embodiment 3 qPCR method and sample detection
[0086] Take the method validation of detecting stem cells in preclinical mouse tissues and whole blood and the mouse tissue distribution test of stem cell drugs as examples:
[0087] 1. Tissue sample collection: Collect whole blood, liver, kidney, spleen, heart, lung and other tissues according to the animal test plan, each tissue is collected at 30-50 mg / part, and then stored in an ultra-low temperature refrigerator for later use.
[0088] 2. Nucleic acid extraction: Genomic DNA was extracted using a commercially available tissue / whole blood genomic DNA extraction kit (blood / cell / tissue genomic DNA extraction kit, Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304). To measure the DNA concentration with a microplate reader, the OD260 / OD280 ratio of the extracted nucleic acid is required to be between 1.6 and 1.9, and the sample with high DNA concentration is diluted to below 0.4 μg / μL with TE Buffer for determinati...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


