Visual screening method of multi-target editing recombinant aspergillus strain

An Aspergillus and strain technology, applied in the field of genetic engineering, can solve the problems of limited selection markers and low homologous recombination efficiency, and achieve the effect of reducing the use of resistance genes and accurately knocking out

Active Publication Date: 2021-02-26
JIANGNAN UNIV
View PDF14 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current gene knockout or blockade of filamentous fungi has the disadvanta

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Visual screening method of multi-target editing recombinant aspergillus strain
  • Visual screening method of multi-target editing recombinant aspergillus strain
  • Visual screening method of multi-target editing recombinant aspergillus strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Using CRISPR-Cas9 to construct a single gene edited recombinant strain of Aspergillus niger

[0046] The CRISPR-Cas9 system includes a gene encoding the Cas9 protein (Cas9 gene), sgRNA, and a selection marker.

[0047] (1) Construction of Cas9 expression vector

[0048] Utilize Aspergillus promoter PglaA (nucleotide sequence as shown in SEQ ID NO.7) or Ptef1 (nucleotide sequence as shown in SEQ ID NO.6) etc. Aspergillus strong promoter expression Cas9 protein (nucleotide sequence is as shown in SEQ ID NO.6) shown in ID NO.1).

[0049] Using Vazyme II One Step Cloning Kit, using pUC19 as the vector backbone, the Aspergillus promoter sequence, gene sequence encoding Cas9 protein, resistance gene and AMA1 (GenBank: X78051.1) sequence were synthesized twice by homologous recombination to obtain Cas9 expression Plasmid pUC19-Cas9 (see the plasmid map figure 1 ). Wherein, a nuclear localization signal NLS sequence (CCCAAGAAGAAGCGCAAGGTC) is added to the N-ter...

Embodiment 2

[0062] Example 2: Screening of Aspergillus niger visualized dual-targeted gene editing recombinant strains

[0063] (1) Construction of Cas9 expression vector

[0064] For specific embodiments, refer to step (1) of Example 1.

[0065] (2) Construction of sgRNA expression cassette

[0066] Utilize the Pu3 mutant promoter (in order to facilitate the assembly of multiple sgRNAs, the associated BsaI site is mutated to facilitate subsequent assembly, specifically the BsaI of the Pu3 promoter sequence with the nucleotide sequence as shown in SEQ ID NO.2

[0067] (GAGACC) site mutation to ACCCAC), target gene protospacers sequence pptA, fwnA, brnA (see Table 1), amyA sequence in Table 5, using tRNA Gly Release the sgRNA expression cassette, the gRNA backbone sequence (the nucleotide sequence is shown in SEQ ID NO.8), and the terminator Tu3 (the nucleotide sequence is shown in SEQ ID NO.4) to construct the sgRNA expression cassette.

[0068] Table 5 Sequence list of target gene pro...

Embodiment 3

[0079] Example 3: Screening of Aspergillus niger visualized multi-targeted gene editing recombinant strains

[0080] For specific embodiments, see Example 2, the difference is that the tRNA behind the promoter in Example 2 Gly replace with tRNA Ala , the second tRNA is replaced by tRNA Phe ;

[0081] Utilize tRNA Ala and tRNA Phe Linked to different sgRNAs. One visualized gene sgRNA expression cassette is fwnA-sgRNA expression cassette, and the other non-phenotype gene sgRNA expression cassette is amyA-sgRNA expression cassette (see plasmid map image 3 ).

[0082]Using the spore color of the Aspergillus niger CCTCC M 2018881 strain as a control, observe the changes in the color phenotype of Aspergillus niger spores after transformation. After knocking out fwnA, the spore color changes from black to white, and 36% of the transformants are white phenotypes, which are directly selected These white single colonies increased the positive selection rate of multiple gene edit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a visual screening method of a multi-target editing recombinant aspergillus strain, and belongs to the technical field of gene engineering. According to the method, CRISPR-Cas9is utilized to shear spore color change related genes and target genes in aspergillus at the same time, so that editing of the target genes is visualized, and aspergillus niger polygene editing strains can be rapidly and efficiently screened out through spore phenotypes. Through different combinations of visual genes and genes without phenotypic change, rapid screening of a multi-gene editing strain and simultaneous screening of the multiple visual genes are realized, and the use of resistance genes in industrial strains is reduced.

Description

technical field [0001] The invention relates to a visual screening method for multi-target editing recombinant Aspergillus strains, belonging to the technical field of genetic engineering. Background technique [0002] Filamentous fungi have a long history of development in the traditional fermentation industry. Among them, Aspergillus is used in food fermentation to produce enzyme preparations and organic acids. Commercially valuable Aspergillus species include Aspergillus niger and Aspergillus oryzae. However, the lack of efficient gene editing methods and rapid screening methods for recombinant strains is an important factor hindering the process of molecular transformation of industrial Aspergillus species. [0003] Aspergillus cells are wrapped by hyphae, and the cell wall structure is more complex than that of prokaryotic cells such as Escherichia coli and Bacillus subtilis. Visual screening of single colonies of Aspergillus is difficult to achieve. A common visual sc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/15C12N15/90C12N9/22C12N15/80C12N15/113C12R1/685
CPCC07K14/38C12N15/902C12N9/22C12N15/80C12N15/113C12N2310/20C12R2001/685C12N15/65C12R2001/68C12R2001/67C12N15/111C12N2320/10C12N1/14C12N15/11C12N2800/10C12N2800/80
Inventor 刘松李岑堵国成陈坚周景文
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap