[0022] Example 1:
[0023] 1. Construction of recombinant plasmids
[0024] 1. Design of gRNA
[0025] Determine the target genes that have CCR effect and contain crebox, a cis-element in the glucose metabolism pathway, and specifically select the following seven target genes:
[0026] ackA UP12_RS13195 acetate kinase
[0027] ycgE UP12_RS01730 aminotransferase
[0028] ptsH UP12_RS06700 phosphocarrierprotein HPr
[0029] budA UP12_RS16915 acetolactate decarboxylase
[0030] acsA UP12_RS13395 acetyl-CoA synthetase
[0031] xylA UP12_RS09365 xylose isomerase
[0032] sucC UP12_RS07835 succinate-CoAligase[ADP-forming]subunitbeta
[0033] Determine the crebox sequence and specific position in the target gene.
[0034] Using the feature that Cas9 protein cuts about 3 bp at the 5' end of the binding site after the gRNA is positioned, select the cre box and the subsequent 20 bp sequence and select PAM as the NNG to design the target fragment. Each gene corresponds to multiple Group possible target fragments, analyze and summarize the seven gene target editing fragments, group them according to the similarity of target fragments, design a single gRNA to cut several target genes with high similarity at the same time, and finally design a The three gRNA sequences are shown in Table 1. The target fragment sequence contains part or all of the cre box sequence, about 4-15 bp. For example, the overlap between the target fragment sequence CGCACCAAATGGCCAGACG of ycgE and the cre box sequence TTGCCAATGCTG is 4 bp. The overlap between the target fragment sequence GTGGAAACGCTACCATCAGT of acsA and the cre box sequence GTGGAAACGCTACCA is 15 bp. If it is less than 4bp, the gene fragment of the target cre box sequence may not be edited.
[0035] Table 1: The three designed gRNA sequences and their similarity to the target fragments of each gene
[0036]
[0037] * Named after the gene name of the type strain Bacillus.subtilis168 (NC_000964.3) with the same function.
[0038] 2. Recombination of gRNA with pCas9 plasmid
[0039] agarose gel electrophoresis
[0040] 1) Preparation of 0.8% agarose gel: Weigh 0.24g of agarose and place it in a conical flask, add 30mL of 1×TAE, heat it in a microwave for 1-2min on high heat until the agarose is completely melted, shake well, and it will be 0.8% Agarose gel liquid. Let stand for a while to cool until it is not hot to the hands and add 3uL of RbGreen dye.
[0041] 2) Glue block preparation: Take the glue-making tank in the electrophoresis tank, wash it, dry it, and put it into the glue-making glass plate. Place the inner tank in a horizontal position and place the comb in a fixed position. The slightly cooled agarose gel was mixed and poured into the inner glass plate carefully, and the entire surface of the glass plate was spread to form a glue layer. Let stand at room temperature until the gel is completely solidified, pull the comb vertically, remove the tape, and put the gel and the inner tank into the electrophoresis tank. Add 1×TAE running buffer to the submerged plate.
[0042]3) Add sample: Mix 2-5μL of the digested plasmid or plasmid stock solution with 1-2μL of 6x bromophenol blue on the spot plate, and then add it to the cavity formed by the comb on the glue block with a 10uL pipette. For one sample, replace one pipette tip to prevent contamination. Be careful not to damage the gel surface around the sample hole when adding the sample. And add 3uL DNAmarker as a control.
[0043] 4) Electrophoresis: Immediately after adding the sample, the gel plate is energized for electrophoresis. The voltage is 100V. The sample moves from the negative electrode (black) to the positive electrode (red) direction. When the bromophenol blue moves to the distance from the gel plate, the lower edge is about 2-3cm. , stop electrophoresis.
[0044] 5) After electrophoresis, take out the gel and observe it in a chemical imager, showing that there is an obvious band just before 10000bp. Tapping recovery (reagents from Beijing Dingguo Changsheng Biotechnology Co., Ltd. DNA Rapid Recovery Kit)
[0045] 6) Under the ultraviolet light of the chemiluminescence imager, cut the glue blocks corresponding to the strips.
[0046] 7) Put the gel block into a 1.5mL centrifuge tube and weigh the gel. Add solution A at a weight ratio of 1:3 (ie, 100 mg of gelatin is added to 300 μL of solution A). After mixing, water bath at 55-60 °C for 10 minutes, during which time the solution is shaken for 2-3 times. Then add 50 μL B and shake to mix.
[0047] 8) Place the mixture in a spin column. Let stand for 2 minutes and centrifuge at 12000rpm for 30s.
[0048] 9) Discard the filtrate, add 500uL of solution C, and centrifuge at 12,000 rpm in the spin column for 30s to discard the liquid.
[0049] 10) Repeat step 4.
[0050] 11) Centrifuge again at 12,000 rpm for 1 min, and spin dry the remaining liquid to remove residual alcohol.
[0051] 12) Put the spin column in a new centrifuge tube, and leave the cap of the centrifuge tube open at room temperature for 5-10 minutes to evaporate the ethanol completely.
[0052] 13) Add 20-60 μL of solution D (solution D is preheated at 50°C before use), and let stand for 2 minutes.
[0053] 14) Centrifuge at 12000rpm for 2min, and the solution at the bottom of the tube is the desired DNA. DNA was stored at -20°C.
[0054] Select a suitable restriction site in the pCas9 plasmid, that is, the BsaI double site, and cut it with the BsaI restriction enzyme. The vector is linearized to form a sticky end, which is verified by electrophoresis and recovered by gel cutting. Add BsaI recognition sites to both ends of the oligonucleotides of the designed Cax, Cac and Cpt gRNAs. After annealing, a cohesive end complementary to the restriction plasmid was obtained. T4 ligase was used to insert the gRNA into the BsaI site of the pCas9 plasmid. Constructed into recombinant plasmids.
[0055] The enzyme digestion system was established as follows:
[0056] Mix the following solutions in a sterile microcentrifuge tube
[0057]
[0058] Incubate for 60 min at 37°C.
[0059] The ligation reaction system is as follows.
[0060] Mix the following reagents in a 200 μL PCR thin-walled tube.
[0061]
[0062] Incubate at 22°C for 6 to 8 hours to obtain recombinant plasmids: pCas9-Cax, pCas9-Cac and pCas9-Cpt.
[0063] 2. CRISPR/Cas9 editing target gene crebox
[0064] 1. Plasmid extraction method (reagents from TaKaRaMiniBEST PlasmidPurificationKitVer.4.0)
[0065] Before the experiment, confirm whether RNaseA is added to Solution I; whether absolute ethanol is added to Buffer wB.
[0066] Before the experiment, put Solution III at 4°C (or on ice) for pre-cooling before use.
[0067] 1) Culture of Escherichia coli. Select a single colony from the plate medium and inoculate it into 2μg/ml liquid LB medium containing chloramphenicol, and culture it overnight at 37°C (culture for 12-16 hours, if the cells are cultured for more than 16 hours, the cells will be difficult to lyse, and the yield of the plasmid will also be reduced. decreased accordingly).
[0068] 2) Take 1-4 ml of the overnight culture solution, centrifuge at 12,000 rpm for 2 minutes, and discard the supernatant.
[0069] 3) Sufficiently suspend the bacterial pellet with 250 μL of Solution I (containing RNaseA).
[0070] Be careful not to leave small bacterial clumps, and vigorously shake the cells with a shaker (Vortex) to fully suspend the cells.
[0071] 4) Add 250 μL of Solution II, gently invert and mix 5 to 6 times to fully lyse the cells and form a transparent solution. Mix gently by inversion, do not shake vigorously, this step should not exceed 5 minutes.
[0072] 5) Add 350 μL of 4°C pre-cooled Solution I, gently invert and mix 5 to 6 times until a firm coagulation is formed, and then stand at room temperature for 2 minutes.
[0073] 6) Centrifuge at 12,000 rpm for 10 minutes at room temperature, and take the supernatant. At this time, centrifugation at 4°C is not conducive to sedimentation.
[0074] 7) Place the Spin Column in the kit on the Collection Tube.
[0075] 8) Transfer the supernatant from step 6 to a Spin Column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate.
[0076] 9) Add 500 μL of Buffer WA to the Spin Column, centrifuge at 12.000 rpm for 30 seconds, and discard the filtrate.
[0077] 10) Add 700 μg of Buffer WB to the Spin Column, centrifuge at 12.000 rpm for 30 seconds, and discard the filtrate.
[0078] 11) Repeat step 10).
[0079] 12) Put SpinCoumn on Cleen Tube again and centrifuge at 1.000rpm for 1 minute to remove residual wash solution.
[0080] 13) Place the Spin Column on a new 1.5m centrifuge tube, add 50 μL of sterilized water or Elution Buffer to the center of the SpinColunn membrane, and let it stand for 1 minute at room temperature. It is beneficial to improve the elution efficiency when using sterile water or Elution Bffer heated to 60C.
[0081] 14) Elute DNA by centrifugation at 12,000 rpm for 1 minute.
[0082] Transfer the recombinant plasmid into E. coli competent cells, add 1 μL of plasmid DNA and 200 μL of competent cells to a 1.5 mL sterile centrifuge tube, mix well, place on ice for 30 min, and put the centrifuge tube on a constant temperature water bath for 90S at 42°C. Put in an ice bath for 1 to 2 minutes. 1 mL of LB culture solution preheated to 37°C was added to the centrifuge tube, shaken at 37°C for 45 minutes, centrifuged to concentrate the cells, and the supernatant was discarded. The bacterial cells were suspended in LB (about 150 μL) liquid medium, and then spread on LB solid plates containing chloramphenicol, and incubated at a constant temperature of 37°C. Plasmids were extracted after transfer to liquid LB culture.
[0083] 2. Protoplast preparation and transformation
[0084] 1) Pick a fresh single colony of Bacillus pumilus SH-B9 from the LB plate cultured for 24 hr, inoculate it in 5 mL of LB liquid medium, and culture for 16-18 hr.
[0085] 2) The next day, 2% bacterial liquid was inoculated into a new 5 mL LB liquid medium, and cultured for 8 hr to the end of the logarithmic growth phase. Take 5 mL of bacterial solution and centrifuge at 12,000 rpm for 1 min at room temperature, and discard the supernatant.
[0086] 3) Add 1 mL of SMMP and lysozyme to make the final concentration of lysozyme reach 0.4 mg/mL, and act at 37° C. for 45 min to prepare protoplasts. After that, lysozyme was removed by centrifugation at 4000 rpm for 10 min, and the protoplasts were resuspended in 0.05 mL of SMMP to obtain "protoplast hypertonic suspension".
[0087] 4) Mix the plasmid DNA to be transformed with an equal volume of 2×SMM solution, and then add 0.05 mL of the “protoplast hypertonic suspension” of the strain to be transformed.
[0088] 5) Immediately after mixing, 0.15 mL of 40% PEG4000 solution was added, and 0.5 mL of SMMP solution was added immediately after incubating in a 37°C water bath for 2 minutes to stop the effect of PEG4000, and then centrifuged at 3000 rpm for 10 minutes.
[0089] 6) After discarding the supernatant, wash once with 1 mL of SMMP solution, centrifuge at 3000 rpm for 10 minutes, discard the supernatant, resuspend with 0.5 mL of SMMP, and incubate for 90 min in a 37°C water bath.
[0090] 7) Spread the bacterial suspension on the CMR selective regeneration medium, and after culturing at 37°C for 24-48 hours, select the transformants.
[0091] The three plasmids were respectively transformed into Bacilluspumilus SH-B9 to obtain recombinant BacilluspumilusLG3145. After examination by scanning electron microscope and atomic force microscope, it was found that there was a large amount of secretion and the growth of capsule, such as attached figure 1 It shows that after the gene change of the strain, the characteristics of the cell wall are larger; the color of the colony on the LB solid medium changes from the white to yellow of the original strain, and the edge of the colony changes from rough to smooth as attached. figure 2 As shown in the figure, it is proved that after the gene change of the strain, the secretion changes; when using LB liquid culture, a large number of white secretions appear on the surface, such as the attached image 3 As shown, it is preliminarily demonstrated that the mutation of the gene leads to increased secretion.
