Cellulase and application thereof
A cellulase and carotene technology, applied in application, enzyme, enzyme and other directions, can solve the problems of narrow temperature tolerance range, rapid loss of enzyme activity, and low catalytic efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Example 1 Cloning of cellulase MkCel2
[0019] Microbacterium kitamiense, a strain with strong cellulose decomposing ability, was obtained by sampling from the wastewater plant in the research laboratory of the inventor. Microbacterium kitamiense is a gram-positive bacterium of the genus Microbacterium, growing at a temperature of 25-42°C and a pH of 6.0.
[0020] According to the complete genome nucleotide sequence of Microbacterium kitamiense reported by GenBank (GenBank accession number: PGGU000000000), the specific primers were designed by Primer X primer design program as follows (direction 5'→3'):
[0021] 16-F: GGGAATTC CATAT GAGGAAAGCCATGATCAGGAT;
[0022] 16-R: CCCC AAGCTT GAGCGCTCCGGCCCGGTGGCCCTA.
[0023] Using the Microbacterium kitamiense genome as a template, PCR amplification was performed using the designed primers, and the products were recovered by agarose gel electrophoresis for identification. The cloned gene was named Mkcel2, and the gene size...
Embodiment 2
[0024] Example 2 Identification of enzymatic properties
[0025] 1. Inclusion body renaturation and purification: Purify and renature the Mkcel2 inclusion body according to the renaturation method commonly used in the prior art;
[0026] 2. Observation of enzyme activity by Congo red staining:
[0027] Congo red dye can penetrate into the network structure of cellulose molecules to make it appear red. If the cellulose is decomposed by enzymes, a light yellow transparent circle will appear. Take 5μL of protein solution and drop it on the identification medium, put it at 25°C for 1h, then rinse the plate with pure water, pour the Congo red solution to immerse the surface of the plate for 10-20min, pour off the dye solution, rinse with pure water, pour 1M The NaCl solution was washed to remove the floating color, and the transparent circle was observed. Depend on figure 1 It can be seen that MkCel2 can form a transparent hydrolysis circle on CMC medium.
[0028] 3. Cellulase ...
Embodiment 3
[0034] Example 3 Screening of mutants with improved thermal stability
[0035]Multiple sequence alignments were performed using the online analysis site ClustalW (http: / / www.genome.jp / tools-bin / clustalw). The thermostable cellulases Cel5 and Cel74 known in the prior art were selected to perform multiple sequence alignment with ROL to identify potential sites that could enhance the thermal stability of ROL. Each sequence was uploaded in FASTA format and the results were uploaded to Espript3.0 (http: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi) and plotted for more intuitive alignment. In order to obtain enzyme proteins with specific amino acid mutations, we used site-directed mutagenesis to try to mutate tyrosine at position 72 to alanine (Y72A) and tyrosine at position 128 to glycine ( Y128G). Then, restriction enzyme DpnI was added at 37°C to remove the unmutated wild-type template. The plasmid treated with restriction enzyme DpnI was transferred into E. coli competent ce...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Vitality | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More