Single-molecule fluorescent gene sequencing optical system
An optical system and fluorescent gene technology, applied in fluorescence/phosphorescence, material analysis through optical means, material analysis, etc., can solve the problems of high equipment cost and sequencing cost, low accuracy, long sequencing read length, etc., and achieve improved The effect of sequencing accuracy and simplification of dependence on multiple image sensors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0044] figure 2 A schematic flow chart of the gene sequencing method according to the embodiment of the invention is shown.
[0045] Select a single strand of DNA to be tested, without loss of generality, the sequence of bases is randomly distributed as follows: AGGCTATGCAAAATCGGAGCG; A, T, G, and C are respectively marked with Alexa Fluor 488, Alexa Fluor 532, and Alexa Fluor 594 on the phosphate segment And Alexa Fluor 647 four different fluorescent molecules, the corresponding center excitation wavelengths are 496nm, 532nm, 590nm and 650nm, and the emission center wavelengths are 519nm, 553nm, 617nm, 665nm respectively. During the sequencing process, the bases to be tested are determined according to the fluorescent signals on the four bases, and the scanning order of the pulsed laser remains unchanged. The polymerization extension time under the action of polymerase is respectively: Ta=1s, Tt=1.2s, Tg=0.8s, Tc=1.5s. The selection of the scan time and the time of the DNA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



