Single-molecule fluorescent gene sequencing optical system

An optical system and fluorescent gene technology, applied in fluorescence/phosphorescence, material analysis through optical means, material analysis, etc., can solve the problems of high equipment cost and sequencing cost, low accuracy, long sequencing read length, etc., and achieve improved The effect of sequencing accuracy and simplification of dependence on multiple image sensors

Active Publication Date: 2021-04-13
CHANGCHUN INST OF OPTICS FINE MECHANICS & PHYSICS CHINESE ACAD OF SCI
View PDF12 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the high detection requirements of the former, the cost of equipment and sequencing has always been very high, and the throughput is limited by the existing nanofabrication technology. The latter has a simple structure and long sequencing read length, but its accuracy is relatively low.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single-molecule fluorescent gene sequencing optical system
  • Single-molecule fluorescent gene sequencing optical system
  • Single-molecule fluorescent gene sequencing optical system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0044] figure 2 A schematic flow chart of the gene sequencing method according to the embodiment of the invention is shown.

[0045] Select a single strand of DNA to be tested, without loss of generality, the sequence of bases is randomly distributed as follows: AGGCTATGCAAAATCGGAGCG; A, T, G, and C are respectively marked with Alexa Fluor 488, Alexa Fluor 532, and Alexa Fluor 594 on the phosphate segment And Alexa Fluor 647 four different fluorescent molecules, the corresponding center excitation wavelengths are 496nm, 532nm, 590nm and 650nm, and the emission center wavelengths are 519nm, 553nm, 617nm, 665nm respectively. During the sequencing process, the bases to be tested are determined according to the fluorescent signals on the four bases, and the scanning order of the pulsed laser remains unchanged. The polymerization extension time under the action of polymerase is respectively: Ta=1s, Tt=1.2s, Tg=0.8s, Tc=1.5s. The selection of the scan time and the time of the DNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a single-molecule fluorescent gene sequencing optical system which is a novel single-molecule real-time sequencing technology based on frequency scanning. The single-molecule fluorescent gene sequencing optical system comprises a sequencing chip and a plurality of single-wavelength pulse laser groups for exciting fluorescent signals, wherein exciting light of the pulse laser groups sequentially irradiates the sequencing chip through a laser light path, and a gene sequence to be detected is sequentially subjected to frequency scanning; then, optical imaging is performed through a fluorescent light path; and sequencing is performed on four basic group phosphoric acid segments of nucleotide molecules modified with different fluorescent molecules. A pulse laser scanning illumination mode is used, so that the light damage of the laser light intensity on DNA polymerase by continuous illumination in the conventional three-generation single-molecule real-time sequencing can be effectively reduced; the pulse scanning time is selected to be shorter than the polymerization extension time, so that in the ATGC cyclic sequencing process, before the next basic group starts to be detected, the sequencing accuracy can be improved through repeated measurement on the previous basic group.

Description

technical field [0001] The invention relates to the technical field of gene sequencing, in particular to a single-molecule fluorescent gene sequencing optical system. Background technique [0002] Gene sequencing technology refers to the identification of the base sequence of a specific DNA fragment, that is, the sequence arrangement of adenine (A), thymine (T), cytosine (C) and guanine (G). At present, the gene sequencing market is mainly dominated by next-generation sequencing technology, typical representatives of which are Illumina's low, medium and high sequencing platforms, and Thermal Fisher's Ion Torrent sequencing platform. Compared with the traditional first-generation sequencing method, the second-generation sequencing has the outstanding characteristics of high throughput and low cost. Although the accuracy is not as good as the traditional sequencing method, due to the analysis of massive data, information beyond the sequence itself can be obtained, so it is als...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12M1/34C12Q1/6874G01N21/64
CPCC12Q1/6874G01N21/6456C12Q2563/107
Inventor周文超吴一辉王越
OwnerCHANGCHUN INST OF OPTICS FINE MECHANICS & PHYSICS CHINESE ACAD OF SCI