Whole-genome random mutation method based on CRISPR-Cas system and application of whole-genome random mutation method

A whole-genome, random mutation technology, applied in the field of bioengineering, can solve the problems of destroying the fidelity of genome replication, poor stability of mutants, single mutation type, etc., reaching single-cell mutation sites with diverse mutation types and high mutation rate , the effect of simple operation

Pending Publication Date: 2021-04-20
EAST CHINA UNIV OF SCI & TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

GREACE starts from destroying the fidelity of genome replication, and constructs cells with high-frequency mutation characteristics, so that they can spontaneously and continuously undergo genome mutations. Genome replication control system to prevent further high-frequency mutations in strains after screening
More importantly, the above-mentioned techniques are often only applicable to specific microorganisms, lacking versatility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Whole-genome random mutation method based on CRISPR-Cas system and application of whole-genome random mutation method
  • Whole-genome random mutation method based on CRISPR-Cas system and application of whole-genome random mutation method
  • Whole-genome random mutation method based on CRISPR-Cas system and application of whole-genome random mutation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1.1 Construction of SpCas9-NG expression vector pCas9-NG:

[0036] Using the pTCL vector (Addgene: #43802) as a template, use two pairs of primers pCas9-NG-F1 / pCas9-NG-R1 and pCas9-NG-F2 / pCas9-NG-R2 to amplify, respectively, to mutate 5 DNA sequences of SpCas9 The codons, specifically L1111R / D1135V / A1322R / R1335V / T1337R, allow the mutated Cas protein Cas9-NG to recognize the NG sequence and expand the Cas protein target; then, the two PCR fragments are circularized into plasmid pCas9 by Gibson assembly -NG.

[0037] Wherein, the nucleotide sequence of pCas9-NG-F1 is shown in SEQ ID NO.5:

[0038] GCTGATCGCACGCAAAAAAGATTGGGACCCCAAAGAAATACGGCGGATTCGTTTCTCCTACAGTCGCTTAC;

[0039] The nucleotide sequence of pCas9-NG-R1 is shown in SEQ ID NO.6:

[0040] CTTTCTGTCTATGGTGGTGTCGAAGTACTTGAAGGCTCGAGGCGCGCCCAAGTTGGTC;

[0041] The nucleotide sequence of pCas9-NG-F2 is shown in SEQ ID NO.7:

[0042] ACCACCATAGACAGAAAGGTGT ACCGCTCTCACAAAGGAGGTCCTG;

[0043] The nucleotide seque...

Embodiment 2

[0057] 2.1 The method of the present invention is applied to the directed evolution and efficiency verification of β-carotene-producing Saccharomyces cerevisiae

[0058] For a strain of Saccharomyces cerevisiae producing β-carotene, the plasmid pCas9-NG was electrotransformed into the cells to obtain strain C0, and then 1 μg of each PCR-amplified toolbox random library fragment expressing gRNA and pSCM linearized plasmid backbone were electrotransformed into C0 For competent cells, the transformed CO competent cells were serially diluted and spread on SD-Leu-Ura plates. Select a plate with 50-200 growing colonies, and finally select a plate with 176 colonies. Compared with the ability to produce β-carotene from the starting strain C0, the β-carotene production capacity of the final 2 bacterial colonies is significantly improved (such as figure 2 shown).

[0059] 2.2 The method of the present invention is applied to the iterative evolution of Saccharomyces cerevisiae producin...

Embodiment 3

[0063] 3.1 Genome-wide mutation analysis of iterative evolution strains

[0064] Using the third-generation genome sequencing platform, analyze the final evolution strain C7-143, process evolution strains C3-06 and C5-63, and the whole genome sequence of the starting strain C0, and compare the mutation sites of the evolution strains compared with C0. The analysis results are as follows Figure 4 and Figure 5 shown.

[0065] On average, each round of evolution can cause 122 mutations in the Saccharomyces cerevisiae genome, and the mutation types are diverse, including base insertion / deletion, duplication, inversion and chromosomal rearrangement.

[0066] Mutation sites are diversified in chromosome locations, distributed in exons, introns, spacers, 3' non-coding regions, and 5' non-coding regions.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a whole-genome random mutation method based on a CRISPR-Cas system and application of the whole-genome random mutation method. The whole-genome random mutation method is based on the CRISPR-Cas system, through the guidance of a random gRNA library, the whole genome of a living body is subjected to scattered bullet type random cutting, and random mutation on the whole genome scale is triggered under the non-fidelity type DNA repair effect. The whole-genome random mutation method can be used for directed evolution and iterative evolution, saccharomyces cerevisiae is used for producing beta-carotene to serve as a verification model, seven rounds of iterative mutation screening are completed within two months, and an evolved strain with the yield increased to 10.5 times is obtained. The omics analysis shows that about 122 mutations can be introduced into each operation on average, the transcription level of about 50% of genes is remarkably changed, it shows that deep remodeling occurs in saccharomyces metabolism through mutation evolution, and experiments prove that the method is a simple and controllable new genome variation technology.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and more specifically relates to a random mutation method of the whole genome based on a CRISPR-Cas system and its application. Background technique [0002] Simulating natural evolution and rapid evolution of living organisms in the laboratory is an important means to study complex metabolic traits of cells, develop new functions of cells and realize biological breeding. The idea of ​​laboratory evolution has a long history. Physical or chemical "mutation" as a means of laboratory evolution has appeared as early as the 1920s. After nearly a hundred years of development, a complete technical and theoretical system has been formed, which actively promotes The rapid development of biological industries such as antibiotics, organic acids, vitamins, steroid pharmaceuticals, modern brewing, enzyme preparations, and crop breeding. Today, mutagenesis is still an important means of breeding in ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N9/22C12N15/81C12N1/19C12R1/865
Inventor王风清赵明魏东芝高苗苗陶欣艺熊亮斌
OwnerEAST CHINA UNIV OF SCI & TECH