Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA/nano-composite as well as preparation method and application thereof

A nanocomposite and nanoparticle technology, which is applied in drug combination, drug delivery, pharmaceutical formulation, etc., can solve the problems of protein complex material design and preparation procedures, difficult to achieve economical efficiency, etc., to improve the effect of tumor treatment and improve the efficacy of tumor treatment Effect

Active Publication Date: 2021-05-04
CHANGSHA MEDICAL UNIV
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, nanoplatform proteins containing siRNA delivery and photothermal conversion functions usually require complex material design and complex preparation procedures, making it difficult to achieve cost-effective, reproducible and mass-produced purposes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA/nano-composite as well as preparation method and application thereof
  • DNA/nano-composite as well as preparation method and application thereof
  • DNA/nano-composite as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] A DNA / nanocomplex including polydopamine, manganese dioxide.

[0055] The polydopamine and manganese dioxide hybrid nanoparticles (PDA@MnO 2 ) is prepared by the following method:

[0056] 14 mg of dopamine hydrochloride was dissolved in 20 mL of tris buffer (10 mM), added with 4 mL of absolute ethanol, stirred at room temperature for 24 h, and centrifuged at 16,000 rpm for 10 min to obtain polydopamine nanoparticles (PDA NPs). Add 1mL KMnO4 solution (1mg / mL) to the above 1mL solution, stir at room temperature for 0.5h, and centrifuge at 16000rpm for 10min to obtain hybrid nanoparticles of polydopamine and manganese dioxide (PDA@MnO 2 NPs) were collected, freeze-dried and weighed for later use.

Embodiment 2

[0058] A DNA / nanocomplex comprising polydopamine, manganese dioxide, DNAzyme (SEQ ID NO. 1: AACAAAAAACAGCAATTCCGAGCCGGTCGAATGGAAAGGCCCCTAA).

[0059] The DNA / nanocomplex of this embodiment is prepared by the following method:

[0060] Will PDA@MnO 2 Nanoparticles were dissolved in HEPES buffer (20mM, pH 7.2, containing 150mM NaCl and 2mM MgCl 2 ), the nanoparticle solution was 200 μg / mL, and then 1 μM DNAzyme was added to incubate for 12 hours. Centrifuge at 16000rpm for 10min, collect the precipitate, and redissolve it with deionized water to obtain the DNA / nanocomplex: PDA@MnO 2 / DZ NPs.

experiment example

[0062] 1. Particle size and potential: respectively detect PDA and PDA@MnO 2 and PDA@MnO 2 / DZ NPs particle size and potential, the measurement method is as follows: take the sample solution and place it in a Marlven Nano ZS instrument, and use the dynamic light laser scattering method to detect the particle size and potential. share. figure 2 , 6 are PDA, PDA@MnO 2 、PDA@MnO 2 / DZ NPs particle size and potential change diagram, from the results of the figure, we can know: PDA particle size is 120nm, potential is -30mV, wrapped with MnO 2 After that, PDA@MnO 2 The particle size is 144nm, the potential is -19.8mV, and after adsorbing DNAzyme, PDA@MnO 2 The / DZ particle size increased to 151nm, and the potential increased to -31.2mV.

[0063] 3. Morphology: Observe PDA@MnO 2 The morphology of NP, the detection method of the morphology: the sample is dropped on the 400-mesh copper grid covered with carbon film, placed in a desiccator, and observed under a transmission ele...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
photothermal conversion efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention discloses a DNA / nano-composite as well as a preparation method and application thereof. The DNA / nano-composite comprises a polydopamine nanoparticle, a manganese dioxide nanoparticle and DNAzyme. The DNA / nano-composite is a core-shell nanoparticle, the polydopamine nanoparticle is taken as a core, the manganese dioxide nanoparticle is taken as a shell, and the DNAzyme is adsorbed on the surface of the shell, wherein the DNAzyme is DNAzyme designed for mRNA of HSP70 protein. In the DNA / nano-composite, the polydopamine core is a good photothermal reagent and can be used for photothermal therapy, and manganese dioxide on the surface of the polydopamine core can be degraded into Mn<2+> under the action of glutathione highly expressed in tumor cells, so that the DNAzyme is activated, the expression of the HSP70 protein is down-regulated, the sensitivity of the tumor cells to the photothermal therapy is improved, and the photothermal therapy is enhanced.

Description

technical field [0001] The invention relates to the field of nanobiotechnology, in particular to a DNA / nano compound and its preparation method and application. Background technique [0002] Photothermal therapy uses photothermal preparations to convert near-infrared light into heat to kill tumor cells. Due to the temporal and spatial controllability of this therapeutic approach, it is considered as a potential tumor therapy. Nano-preparations used in photothermal therapy need to have good photothermal conversion capabilities, such as polydopamine nanoparticles, gold nanoparticles, Prussian blue nanoparticles and so on. However, cunning tumor cells can acquire thermotolerance by upregulating heat shock proteins (HSPs), which weakens the therapeutic and prognostic effects of photothermal. HSPs are highly conserved molecular chaperones induced by various environmental or pathophysiological stresses. Among them, HSP70 is one of the most active heat-resistant proteins that pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K41/00A61K31/7088A61K33/32A61K47/54A61K47/69A61P15/14A61P35/00
CPCA61K41/0052A61K33/32A61K31/7088A61K47/6929A61K47/549A61P35/00A61P15/14A61K2300/00
Inventor 周文虎席洋
Owner CHANGSHA MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com