DNA/nano-composite as well as preparation method and application thereof
A nanocomposite and nanoparticle technology, which is applied in drug combination, drug delivery, pharmaceutical formulation, etc., can solve the problems of protein complex material design and preparation procedures, difficult to achieve economical efficiency, etc., to improve the effect of tumor treatment and improve the efficacy of tumor treatment Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] A DNA / nanocomplex including polydopamine, manganese dioxide.
[0055] The polydopamine and manganese dioxide hybrid nanoparticles (PDA@MnO 2 ) is prepared by the following method:
[0056] 14 mg of dopamine hydrochloride was dissolved in 20 mL of tris buffer (10 mM), added with 4 mL of absolute ethanol, stirred at room temperature for 24 h, and centrifuged at 16,000 rpm for 10 min to obtain polydopamine nanoparticles (PDA NPs). Add 1mL KMnO4 solution (1mg / mL) to the above 1mL solution, stir at room temperature for 0.5h, and centrifuge at 16000rpm for 10min to obtain hybrid nanoparticles of polydopamine and manganese dioxide (PDA@MnO 2 NPs) were collected, freeze-dried and weighed for later use.
Embodiment 2
[0058] A DNA / nanocomplex comprising polydopamine, manganese dioxide, DNAzyme (SEQ ID NO. 1: AACAAAAAACAGCAATTCCGAGCCGGTCGAATGGAAAGGCCCCTAA).
[0059] The DNA / nanocomplex of this embodiment is prepared by the following method:
[0060] Will PDA@MnO 2 Nanoparticles were dissolved in HEPES buffer (20mM, pH 7.2, containing 150mM NaCl and 2mM MgCl 2 ), the nanoparticle solution was 200 μg / mL, and then 1 μM DNAzyme was added to incubate for 12 hours. Centrifuge at 16000rpm for 10min, collect the precipitate, and redissolve it with deionized water to obtain the DNA / nanocomplex: PDA@MnO 2 / DZ NPs.
experiment example
[0062] 1. Particle size and potential: respectively detect PDA and PDA@MnO 2 and PDA@MnO 2 / DZ NPs particle size and potential, the measurement method is as follows: take the sample solution and place it in a Marlven Nano ZS instrument, and use the dynamic light laser scattering method to detect the particle size and potential. share. figure 2 , 6 are PDA, PDA@MnO 2 、PDA@MnO 2 / DZ NPs particle size and potential change diagram, from the results of the figure, we can know: PDA particle size is 120nm, potential is -30mV, wrapped with MnO 2 After that, PDA@MnO 2 The particle size is 144nm, the potential is -19.8mV, and after adsorbing DNAzyme, PDA@MnO 2 The / DZ particle size increased to 151nm, and the potential increased to -31.2mV.
[0063] 3. Morphology: Observe PDA@MnO 2 The morphology of NP, the detection method of the morphology: the sample is dropped on the 400-mesh copper grid covered with carbon film, placed in a desiccator, and observed under a transmission ele...
PUM
| Property | Measurement | Unit |
|---|---|---|
| photothermal conversion efficiency | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


