Recombinant microorganism and application thereof, and method for preparing shikimic acid and oseltamivir

A technology for recombining microorganisms and shikimic acid, which is applied in the biological field to achieve the effect of enhancing carbon source uptake ability

Active Publication Date: 2021-05-11
HEC PHARM
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the current method of using genetic engineering to modify microorganisms to synthesize shikimic acid still needs to be improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant microorganism and application thereof, and method for preparing shikimic acid and oseltamivir
  • Recombinant microorganism and application thereof, and method for preparing shikimic acid and oseltamivir
  • Recombinant microorganism and application thereof, and method for preparing shikimic acid and oseltamivir

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Example 1 Escherichia coli gene editing vector pTargetF2-ptsH construction

[0097] In the following examples, referring to Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system, Appl Environ Microbiol 2015Apr; 81(7):2506-2514, the CRISPR-Cas9 system was used for gene editing of Escherichia coli. The CRISPR-Cas9 system used in Escherichia coli consists of two basic plasmids, pCas-lac and pTargetF2. refer to image 3 The pCas-lac plasmid mainly includes the L-arabinose-induced expression of the Red recombinase element, the Cas9 protein coding gene Cas9, the temperature-sensitive element, and the sgRNA used to induce the elimination of the plasmid pTargetF, the kanamycin resistance gene KanR, etc. To produce cas9 protein with cleavage activity and improve recombination efficiency. The pTargetF2 plasmid mainly contains the resistance gene aadA and the sgRNA expression cassette, which is used to guide the cas9 editing site.

[0098] Use online softw...

Embodiment 2

[0104] The preparation of embodiment 2 escherichia coli donor fragment (Donor)

[0105] Preparation of ptsHIcrr-T7-glf-glk-Donor

[0106] According to the upstream and downstream sequences of the E. coli BL21 (DE3) ptsHIcrr gene and the pUC57-glf-glk vector (see SEQ ID NO.4 for the glf-glk sequence), primers were designed as follows:

[0107] SEQ ID NO. 5: AAAGGCACCAAAGGCAAGAC

[0108] SEQ ID NO. 6: CCTATAGTGAGTCGTATTATGTATTTCCCCAACTTATA

[0109] SEQ ID NO. 7: TAATACGACTCACTATAGGTGTGGATCTCCTTCTTAAAGT

[0110] SEQ ID NO. 8: CAAAGATTTTCAAAAAACCCCTCAAGACCC

[0111] SEQ ID NO.9: GTTTTTTGAAAATCTTTGAAACCAACCACG

[0112] SEQ ID NO. 10: CCAGCAGCATGAGAGCGATG

[0113]

[0114]

[0115]ATGAGCAGCGAAAGCAGTCAGGGTCTGGTGACCCGTCTGGCCCTGATTGCAGCCATTGGCGGCCTGCTGTTTGGCTATGATAGCGCAGTGATCGCCGCCATTGGCACACCGGTTGATATTCACTTCATCGCCCCGCGCCATTTAAGCGCAACCGCAGCCGCCAGCCTGAGTGGTATGGTGGTTGTTGCAGTGCTGGTGGGCTGCGTGACCGGTAGCTTACTGAGCGGTTGGATCGGTATTCGTTTCGGCCGCCGTGGTGGTCTGCTGATGAGTAGCATCTGCTTTGTGGCAGCCGG...

Embodiment 3

[0157] Example 3 Construction of Escherichia coli producing shikimic acid host

[0158] First, referring to the method in Example 1 of CN111057672A, the ESA-3 (pcas-lac) electroporation competence carrying the pcas-lac plasmid was constructed.

[0159] In short,

[0160] a. Escherichia coli containing the pCas-lac plasmid was inoculated into liquid LB (containing kanamycin at a final concentration of 50 μg / mL) medium, and cultured at 30° C. and 250 rpm / min until the logarithmic growth phase.

[0161] b. Inoculate in a 500mL Erlenmeyer flask equipped with 100mLLB (containing kanamycin final concentration of 50 μg / mL) medium with 1% inoculum size, cultivate at 30°C and 200rpm / min until OD600 is 0.2~0.3, Add L-arabinose inducer at a final concentration of 10mmol / L to induce sufficient expression of λ-Red recombinase on pCas-lac, and stop culturing when OD600 is 0.5-0.7 (1-1.5h).

[0162] c. Transfer the culture solution to a 50mL sterile centrifuge tube in the ultra-clean bench...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant microorganism for producing shikimic acid, the use of the microorganism in the preparation of shikimic acid, a method for preparing shikimic acid and a method for preparing oseltamivir. According to the recombinant microorganism, a PTS system and shikimic acid kinase of the recombinant microorganism are down-regulated, and the 3-dehydroquinic acid synthetase, the 3-dehydroquinic acid dehydratase, the 3-deoxy-D-arabinoheptulose-7-phosphate synthetase, the shikimic acid dehydrogenase, the transketolase I and the phosphoenolpyruvate synthetase of the recombinant microorganism are up-regulated, the recombinant microorganism further carries an exogenous nucleic acid encoding at least one of (A) an exogenous inositol transporter or a functional analog thereof, and (B) an exogenous glucose transporter or a functional analogue thereof, and shikimic acid can be efficiently produced by using the recombinant microorganism.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the invention relates to a recombinant microorganism for producing shikimic acid, the use of the microorganism in preparing shikimic acid, a method for preparing shikimic acid and a method for preparing oseltamivir. Background technique [0002] Shikimic acid (sometimes referred to herein simply as "SA") is a small organic acid with the following chemical structure: [0003] [0004] Shikimic acid is a key intermediate for several important compounds such as aromatic amino acids, pantothenic acid, folic acid, and vitamin K12. In addition, shikimic acid is an important precursor for the synthesis of some indole derivatives, alkaloids and some chiral (such as antiviral drugs), and has a wide range of medicinal value. At present, shikimic acid is also a key intermediate in the synthesis of antiviral drug oseltamivir phosphate (Tamiflu). [0005] During the large-scale outbreak of bird...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/31C12N15/54C12N15/70C12P7/42C12P13/02C12R1/19
CPCC12N9/1205C12N9/88C12N9/0006C12N9/1022C12N9/1294C12N9/1085C07K14/34C07K14/195C12P7/42C12P13/02C12Y207/01071C12Y402/03004C12Y402/0101C12Y101/01025C12Y202/01001C12Y207/09002C12Y205/01054
Inventor蔡燕丰徐宇骋谢文平刘翠翠王鑫鑫梁在华温素萍鲍素敏
OwnerHEC PHARM