Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells

A technology for expressing vectors and vector skeletons, applied in biochemical equipment and methods, chemical instruments and methods, cells modified by introducing foreign genetic materials, etc., can solve the problem of inactivation of receptor proteins, inability to infect live pigs, and reduced infectivity And other issues

Active Publication Date: 2021-05-11
NANJING KGENE GENETIC ENG CO LTD
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Destroying the pAPN gene will inactivate the receptor protein encoded by it, the TGEV virus canno

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistance to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of high-quality porcine nuclear transplantation donor cells

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0093]Example 1, Construction of Plasmid

[0094]1.1 Construction plasmid Pu6GRNA EEF1A-MNLS-HSPCas9-EGFP-PURO (referred to as plasmid pkg-ge3)

[0095]The original plasmid PX330-U6-chiMERIC_BB-CBH-HSPCAS9 (referred to as plasmid PX330), the sequence is shown in SEQ IDNO.1. Structure of plasmid PX330figure 1 . In SEQ ID NO.1, the 440-725 nucleotides composition CMV enhancer, sections 727-1208 nucleotides composition Chickenβ-Actin promoter, No. 1304-1324 Nucleotide encoded SV40 nuclear positioning signal (NLS ), No. 1325-5449 Nucleotide encoding Cas9 protein, race 5450-5497 Nucleotide coded Nucleoplasmin nuclear positioning signal (NLS).

[0096]Plasmid PU6GRNA EEF1A-MNLS-HSPCas9-EGFP-PURO (Figure 5 ), Referred to as plasmid pKG-GE3, nucleotide, such as SEQ ID NO.2. Compared with the plasmid PX330, plasmid PKG-GE3 mainly has been modified as follows: 1 Remove residual GRNA skeleton sequence (gtttAmaAgcccccccccccccccgtttttt), reduce interference; 2 Transform the original Chickenβ-Actin promot...

Example Embodiment

[0109]Example 2 Comparison of plasmid ratio optimization and meta-plasmid PX330 and plasmid PKG-GE3

[0110]2.1 target GRNA design and construction

[0111]2.1.1 Target GRNA Design for Rag1 genes using Benchling

[0112]RAG1-G4: Agttatgcagaactcagtg (seq ID no.9)

[0113]The complementary DNA Oligo of the insertion sequence for the synthesis of the above RAG1 gene target is as follows:

[0114]RAG1-GRNA4S: caccgagttatgcagaactcagtg (seq ID no.10)

[0115]RAG1-GRNA4A: AAACCACTGAGTTCTGCCCCATAACTC (SEQ ID NO.11)

[0116]RAG1-GRNA4S, RAG1-GRNA4A are single-stranded DNA molecules.

[0117]2.1.2 Design for amplification and detection of primers containing RAG1 GRNA target fragment

[0118]RAG1-NF126: ccccatccaaagttttaaagga

[0119]RAG1-NR525: TGTGCAGATGTCAGTTTTAGG

[0120]2.1.3 Construction of GRNA recombinant carrier and cloning

[0121]1) Digest 1 ug PKG-U6GRNA plasmid with restriction endonuclease BBSI;

[0122]2) Separation of PKG-U6GRNA grain routine gel (agarose gel concentration 1%, i.e., 1 g agarose gel added to 100 mL e...

Example Embodiment

[0170]Example 3 Screening an efficient MSTN gene GRNA target

[0171]Pig MSTN gene information: encoded myostatin protein; located in the pig No. 15 chromosome; GeneId is 399534, SUsscrofa. Pig MSTN gene encoding proteins such as GenBank Accession No.NP_999600.2 (Linear Con12-JAN-2018), the amino acid sequence is shown in SEQ ID NO.13. In the genome DNA, the pig MSTN gene has three exons, wherein the first exon and downstream 200bp sequences are shown in SEQ ID NO.14.

[0172]3.1 MSTN gene knockout preset target and adjacent genomic sequence conservative analysis

[0173]18 new students from Jiangxiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), male 8 (named A, B, C, D, respectively , E, F, G, H).

[0174]The PCR amplification is performed using primer pairs (primer pair target sequences including pig MSTN gene first exons), respectively, and electrophoresis. The PCR amplification product was recovered and sequenced, and the sequencing results were aligned with the MSTN g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth and resistant to porcine reproductive and respiratory syndrome and series diarrhea diseases and application of the high-quality porcine nuclear transplantation donor cells. A CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9) system for porcine MSTN-SST-CD163-pAPN four-gene editing contains a Cas9 expression vector and gRNA (guide Ribonucleic Acid) expression vectors aiming at a porcine MSTN gene, an SST gene, a CD163 gene and a pAPN gene, and plasmid complete sequence of the Cas9 expression vector is as shown in SEQ ID NO.2. According to the invention, the corresponding gRNA expression vectors are designed for different targets of MSTN, SST, CD163 and pAPN genes, and gRNA with relatively high editing efficiency and the gRNA expression vector are obtained through screening. Through cooperation with the modified Cas9 efficient expression vector for gene editing, the editing efficiency is remarkably improved as compared with that of an original vector.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for constructing high-quality pig nuclear transplantation donor cells with high lean meat rate, fast growth and resistance to blue ear disease and serial diarrhea diseases and its application, in particular to the use for MSTN, SST, CD163, pAPN Four-gene edited CRISPR / Cas9 system and its application in the construction of high-quality pig nuclear transfer donor cells with high lean meat percentage, fast growth and resistance to PRRS and serial diarrheal diseases. Background technique [0002] Pig is one of the earliest domesticated domestic animals in my country, and it has always been an important meat animal for human beings in the long river of history. The Chinese love to eat pork is related to the food culture for thousands of years. Since 2000, pork has accounted for more than 70% of my country's meat consumption, and it is the most important meat consumed in my country...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/65C12N5/10A01K67/027
CPCC12N15/8509C07K14/47C12N15/65A01K67/0276C12N2310/20A01K2227/108A01K2267/02A01K2267/025
Inventor 牛冬汪滔马翔曾为俊刘璐王磊程锐赵泽英段星陶裴裴黄彩云
Owner NANJING KGENE GENETIC ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap