CRISPR system and application thereof to construction of cloned porcine nuclear donor cells with GABRG2 gene mutation

A gene and gene editing technology, applied in the field of gene editing, can solve problems such as lack of standardized professional treatment

Active Publication Date: 2021-06-04
NANJING KGENE GENETIC ENG CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to China Youth Daily, about 80% of patients with depression in China have not been "discovered", and 90% have not received standardized professional treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR system and application thereof to construction of cloned porcine nuclear donor cells with GABRG2 gene mutation
  • CRISPR system and application thereof to construction of cloned porcine nuclear donor cells with GABRG2 gene mutation
  • CRISPR system and application thereof to construction of cloned porcine nuclear donor cells with GABRG2 gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, the construction of plasmid

[0046] 1.1 Construction of plasmid pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (referred to as plasmid pKG-GE3)

[0047] The sequence of the original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (abbreviated as plasmid pX330) is shown in SEQ ID NO.1. The schematic diagram of the structure of plasmid pX330 is shown in figure 1 . In SEQ ID NO.1, the 440-725 nucleotides form the CMV enhancer, the 727-1208 nucleotides form the chickenβ-actin promoter, and the 1304-1324 nucleotides encode the SV40 nuclear localization signal (NLS ), the 1325-5449th nucleotide encodes the Cas9 protein, and the 5450-5497th nucleotide encodes the nucleoplasmin nuclear localization signal (NLS).

[0048] Plasmid pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO, referred to as plasmid pKG-GE3, the nucleotide is shown in SEQID NO.2, and the plasmid map is shown in Figure 5 shown. Compared with the plasmid pX330, the plasmid pKG-GE3 has been mainly modified as follows: ① ...

Embodiment 2

[0061] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0062] 2.1 Target gRNA design and construction

[0063] 2.1.1 Using Benchling to design target gRNA for RAG1 gene

[0064] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)

[0065] Synthesize complementary DNA Oligo for the insertion sequence of the above-mentioned RAG1 gene target as follows:

[0066] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)

[0067] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)

[0068] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0069] 2.1.2 Primers designed to amplify and detect fragments containing the RAG1 gRNA target

[0070] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA (SEQ ID NO. 12)

[0071] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG (SEQ ID NO. 13)

[0072] 2.1.3 The method of cloning the gRNA sequence into the pKG-U6gRNA backbone vector

[0073] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease ...

Embodiment 3

[0122] Example 3 Design and construction of GABRG2 gene target gRNA

[0123] 3.1 Genomic DNA extraction

[0124] 18 pigs (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5) were respectively performed using Vazyme's FastPure Cell / Tissue DNA Isolation Mini Kit (VazymeCat.DC102-01). , 6, 7, 8, 9, 10) Genomic DNA from ear tissue was extracted by column, quantified using NanoDrop, and stored at -20°C for future use.

[0125] 3.2 GABRG2 gene knockout predetermined target and adjacent genome sequence conservation analysis

[0126] 3.2.1 Gene information of porcine GABRG2

[0127] γ-aminobutyric acid type A receptor subunit gamma2 (gamma-aminobutyric acid type A receptor subunit gamma2); located on chromosome 16; GeneID is 100516405, Sus scrofa. The amino acid sequence encoded by the porcine GABRG2 gene is shown in SEQ ID NO.15. Existing research results have shown that GABRG2 is of great significance for GABAA receptor transport and synaptic function. In the pig genome DNA, the G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a CRISPR system and an application thereof to construction of cloned porcine nuclear donor cells with GABRG2 gene mutation. A CRISPR / cas9 system for porcine GABRG2 gene editing comprises a Cas9 efficient expression vector pKG-GE3 with the sequence shown in SEQ ID NO.2 and a gRNA expression vector aiming at the porcine GABRG2 gene, the vector takes pKG-U6gRNA with the sequence shown in SEQ ID NO.3 as a vector framework, and the gRNA with the sequence shown in SEQ ID NO.35 is expressed. When the screened gRNA combined modified Cas9 efficient expression vector is used for gene editing, the editing efficiency is remarkably improved compared with that of the original vector.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and in particular relates to a CRISPR system and its application in constructing cloned pig nucleus donor cells with GABRG2 gene mutation. Background technique [0002] Depression, also known as depressive disorder (Mood disorder), with significant and persistent low mood as the main clinical feature, is the main type of mood disorders. It can be seen clinically that the mood is not commensurate with the situation. The depression of mood can range from gloomy to distraught, low self-esteem and depression, even pessimistic world-weariness, and there may be suicide attempts or behaviors; even stupor; some cases have obvious anxiety and motor agitation; In severe cases, psychotic symptoms such as hallucinations and delusions may appear. Each attack lasts for at least 2 weeks, or even several years in the elderly. Most cases have a tendency to recur. Most of each attack can be relieved, and som...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/113C12N5/10C12N9/22A01K67/027
CPCC12N15/8509C12N15/1138C12N9/22C12N5/0656C07K14/70571A01K67/0276C12N2310/20A01K2207/15A01K2217/075A01K2227/108A01K2267/0356Y02A50/30
Inventor 牛冬汪滔陶裴裴曾为俊刘瑜王磊程锐赵泽英马翔黄彩云
Owner NANJING KGENE GENETIC ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap