Gene engineering strain of amycolatopsis, construction method and application thereof

A pseudomycobacterial and gene technology, applied in the field of genetic engineering, can solve the problems of undeveloped gene editing tools, little research on gene manipulation, accumulation of vanillic acid, etc., and achieves favorable extraction process, high integration efficiency, and improved transformation rate. Effect

Pending Publication Date: 2021-07-02
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

We have adopted atmospheric pressure room temperature plasma mutagenesis (ARTP) on the strain, although the molar yield of the precursor to the strain has increased to 72.1%, but other by-products such as vanillic acid are still accumulated
In addition, Amycolatopsis CCTCCNO:M2011265 is a wild fungus that produces vanillin industrially. There are few studies on its genetic manipulation, and a set of mature gene editing tools has not been developed, so gene editing is a challenge

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene engineering strain of amycolatopsis, construction method and application thereof
  • Gene engineering strain of amycolatopsis, construction method and application thereof
  • Gene engineering strain of amycolatopsis, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Using the CRISPR / Cas9 editing system to knock out the vanillin dehydrogenase Vdh gene in Amycolatopsis bacterium

[0035] 1. Construction and verification of plasmid pKCKmCas9Vdh

[0036] step one,

[0037] pKCcas9dO was digested with Nde I / Hind III to obtain the cas9sco vector. The enzyme digestion system was: 2 μL of plasmid, 1 μL of NdeI and Hind III endonucleases, 1 μL of Buffer, replenished with water to 10 μL, and reacted in a 37°C water bath for 30 minutes.

[0038] Step 2. Obtaining sgRNA recombinant fragments

[0039] The vanillin dehydrogenase Vdh gene of Amycolatopsis zhp06 was used as the editing target to design sgRNA, and pKCcas9dO was used as template, and the sgRNA recombinant fragment (SEQ ID NO:11) was obtained by PCR amplification with primers P1 and P2. The fragment size was 127bp, the sgRNA recombination fragment contains a 20bp target gene (vdh) sequence.

[0040] P1: CGCCTCGCCCCAGGACCTGGCGTTTTAGAGCTAGAAATAGCAAGT

[0041] (SEQ ID NO:1...

Embodiment 2

[0077] Example 2 Analysis of fermentation products of Amycolatopsis sp.Δvdh, a genetic engineering bacterium of Amycolatopsis

[0078] Seed medium formula: glucose 5g, yeast extract 10g, Na 2 HPO 4 4g, KH 2 PO 4 1g, NaCl 0.2g, MgSO 4 ·7H 2 O 0.2g, CaCl 2 2H 2 O 0.05g, distilled water 1000mL, pH adjusted to 7.2;

[0079] Growth cell transformation medium formula: glucose 50g, yeast extract 1g, Na 2 HPO 4 4g, KH 2 PO 4 0.1g, NaCl0.2g, MgSO 4 0.2g, CaCl 2 0.05g, distilled water 1000mL, pH adjusted to 7.2.

[0080] The mutant strain of Amycolatopsis sp.Δvdh and the original strain were inoculated in the seed medium respectively, and cultured in a constant temperature shaker at 30°C and 180r / min for 36h. Inoculate growth cell transformation medium with 8% inoculum, place in 30°C, 180r / min constant temperature shaker for culture, add substrate ferulic acid with a final concentration of 12g / L after 20h, and raise the culture temperature to 35°C at the same time, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene engineering strain of amycolatopsis, a construction method and application thereof, and belongs to the technical field of genetic engineering. According to a method for performing gene knockout in amycolatopsis producing vanillin by using a CRISPR / Cas9 editing system, a CRISPR / Cas9 editing plasmid pLYZYP01 containing a Vdh gene homologous arm is introduced into amycolatopsis CCTCCM 2011265 to achieve vdh gene knockout, and under the condition that 12 g / L of substrate ferulic acid is added into the obtained genetic engineering strain Amycolatopsis sp.delta vdh, the yield of vanillin reaches 9.19 g / L, and the molar conversion rate is 97.7, so that good industrial application value is shown.

Description

technical field [0001] The invention relates to a genetic engineering bacterium of Amycolatopsis bacterium and its construction method and application, especially a genetic engineering bacterium obtained by knocking out the Vdh gene of vanillin dehydrogenase in Amycolatopsis bacterium by using the CRISPR / Cas9 editing system, It belongs to the technical field of genetic engineering. Background technique [0002] Vanillin is the main component of vanilla, also known as vanillin, the chemical name is 3-methoxy-4-hydroxybenzaldehyde, and has the reputation of "Queen of Spices". Vanillin is one of the most widely used spices in industry, widely used in food, chemical industry, medicine, agriculture and other aspects. In terms of food, it is widely used as a food additive in chocolate, cream, cocoa, ice cream, famous wine and other high-end foods; in chemical industry, it can be used in toothpaste, soap, perfume and various cosmetics, and is used in the preparation of various hyg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12P7/24C12R1/01
CPCC12N15/74C12N9/0008C12Y102/01067C12P7/24C12N2310/20
Inventor郑璞郑义培吴丹陈鹏程
OwnerJIANGNAN UNIV