Gene engineering strain of amycolatopsis, construction method and application thereof
A pseudomycobacterial and gene technology, applied in the field of genetic engineering, can solve the problems of undeveloped gene editing tools, little research on gene manipulation, accumulation of vanillic acid, etc., and achieves favorable extraction process, high integration efficiency, and improved transformation rate. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Using the CRISPR / Cas9 editing system to knock out the vanillin dehydrogenase Vdh gene in Amycolatopsis bacterium
[0035] 1. Construction and verification of plasmid pKCKmCas9Vdh
[0036] step one,
[0037] pKCcas9dO was digested with Nde I / Hind III to obtain the cas9sco vector. The enzyme digestion system was: 2 μL of plasmid, 1 μL of NdeI and Hind III endonucleases, 1 μL of Buffer, replenished with water to 10 μL, and reacted in a 37°C water bath for 30 minutes.
[0038] Step 2. Obtaining sgRNA recombinant fragments
[0039] The vanillin dehydrogenase Vdh gene of Amycolatopsis zhp06 was used as the editing target to design sgRNA, and pKCcas9dO was used as template, and the sgRNA recombinant fragment (SEQ ID NO:11) was obtained by PCR amplification with primers P1 and P2. The fragment size was 127bp, the sgRNA recombination fragment contains a 20bp target gene (vdh) sequence.
[0040] P1: CGCCTCGCCCCAGGACCTGGCGTTTTAGAGCTAGAAATAGCAAGT
[0041] (SEQ ID NO:1...
Embodiment 2
[0077] Example 2 Analysis of fermentation products of Amycolatopsis sp.Δvdh, a genetic engineering bacterium of Amycolatopsis
[0078] Seed medium formula: glucose 5g, yeast extract 10g, Na 2 HPO 4 4g, KH 2 PO 4 1g, NaCl 0.2g, MgSO 4 ·7H 2 O 0.2g, CaCl 2 2H 2 O 0.05g, distilled water 1000mL, pH adjusted to 7.2;
[0079] Growth cell transformation medium formula: glucose 50g, yeast extract 1g, Na 2 HPO 4 4g, KH 2 PO 4 0.1g, NaCl0.2g, MgSO 4 0.2g, CaCl 2 0.05g, distilled water 1000mL, pH adjusted to 7.2.
[0080] The mutant strain of Amycolatopsis sp.Δvdh and the original strain were inoculated in the seed medium respectively, and cultured in a constant temperature shaker at 30°C and 180r / min for 36h. Inoculate growth cell transformation medium with 8% inoculum, place in 30°C, 180r / min constant temperature shaker for culture, add substrate ferulic acid with a final concentration of 12g / L after 20h, and raise the culture temperature to 35°C at the same time, ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com