Unlock instant, AI-driven research and patent intelligence for your innovation.

An ultra-high-throughput single-cell sequencing method

A single-cell sequencing and cell-based technology, applied in the field of single-cell sequencing, can solve problems such as batch effects, high sequencing costs, and difficult portability

Active Publication Date: 2022-05-24
ZHEJIANG UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the microfluidics-based sequencing platform cells are not tested in parallel, the batch effect problem is more significant, and there are disadvantages such as expensive equipment, not easy to carry, and high sequencing costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An ultra-high-throughput single-cell sequencing method
  • An ultra-high-throughput single-cell sequencing method
  • An ultra-high-throughput single-cell sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] 1. Microplate preparation

[0056] According to the experimental scale (500,000 human 293T cells and 500,000 mouse 3T3 cells each), the size of the microwell plate (well plate size is 1.8cm×1.8cm) is designed, and the microwell is etched on the silicon wafer as the initial mold, and the microwell is a cylinder Body shape, in which the micropore depth is 60 μm, the micropore diameter is 50 μm, and the hole spacing is 70 μm. Next, polydimethylsiloxane (PDMS) was poured on the silicon wafer. After molding, the PDMS was taken out to become the second mold with micro-pillars on the plate. The microplate used in the final experiment was a concentration of 5% (mass ratio ) of agarose (prepared with enzyme-free water), poured on the PDMS micro-column plate after heat-melting and condensed to form, and the agarose plate at this time is peeled off to form a micro-well plate with a certain thickness ( figure 1 ). When storing, add DPBS-EDTA mixture, which is harmless to cells, ...

Embodiment 2

[0067] Human 293T, murine 3T3 mixed cell test.

[0068] Mouse embryonic stem cells (ESC) 3T3 and human embryonic kidney cells (293T), 5 million each, were slowly added dropwise with 5-10 ml methanol (-20 °C pre-cooling) and fixed at -20 °C for 30 minutes. At the same time, the bridging primers were distributed. Put 6.5 μl per well in an eight-coupled tube, and then dispense it into a 96-well plate containing 0.5 μl of reverse transcription primers, and let it stand and mix to form a total of 1 μl of reverse transcription mixed primers per well. The bridging primer sequence is 5'- CGTCGTGTAGGGAAAGAGTGT GACGCTGCCGACGA[ddC]-3', ddC modification at the 3' end prevents the generation of by-products caused by the extension of the bridging primer during reverse transcription.

[0069] The reverse transcription primers (reverse transcription sequences) are also 96 kinds of the above cell tag sequences, the core sequence is 6×N, each primer is placed independently in each well, this ...

Embodiment 3

[0085] cDNA sequencing library construction.

[0086] (1) 5ng initial DNA fragmentation

[0087] Use Vazyme TD512 kit.

[0088] (a) Thaw 5×TTBL (TruePrep Tagment Buffer L) at room temperature, invert and mix well before use. Confirm that 5×TS (Terminate Solution, reaction stop solution) is at room temperature, and flick the tube wall to confirm the presence or absence of precipitation. If there is precipitation, it can be dissolved by heating at 37°C and vigorously shaking to mix well.

[0089] (b) Add each reaction component in sequence to a sterilized PCR tube:

[0090] 5 x TTBL 4 μl

[0091] DNA 5ng

[0092] TTE Mix V1 5μl

[0093] ddH 2 O make up to 20 μl.

[0094] (c) Mix well by gently pipetting 20 times with a pipette.

[0095] (d) The PCR tube was placed in the PCR machine, and the following reaction program was set: 55°C for 10 min; incubation at 10°C.

[0096] (e) Immediately add 5 μl of 5×TS to the reaction product, and mix well by gently pipetting with a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an ultra-high-throughput single-cell sequencing method. The ultra-high-throughput single-cell sequencing method of the present invention uses molecular marker microbeads, reverse transcription sequences, and bridging primers. Intracellular reverse transcription is performed once, and then the cells after intracellular reverse transcription are placed in a space separated by a molecular marker microbead and one or more cells through microwell plate technology or microfluidic technology. The cells were lysed under the action of the lysate, and the sequences obtained after reverse transcription were connected with the molecular marker sequences on the molecular marker microbeads with the help of bridging primers, and a large number of sequences were obtained by PCR amplification, and the cDNA sequencing library was constructed, and then carried out High-throughput sequencing, one-time sequencing can obtain the specific transcriptome information of millions of single cells. The throughput of single-cell sequencing has been greatly improved.

Description

technical field [0001] The invention relates to the technical field of single-cell sequencing, in particular to an ultra-high-throughput single-cell sequencing method. Background technique [0002] Since Tang Fuchou proposed single-cell sequencing technology in 2009, single-cell high-throughput sequencing platforms have sprung up. wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell, 2015.161(5):p.1202-1214.) and inDrop-seq (Klein, Allon M., et al., Droplet Barcoding for Single-Cell Transcriptomics Applied to Embryonic StemCells. Cell, 2015.161(5): p.1187-1201.) platform, Microwell-seq (Han, X., et al., Mapping the Mouse Cell Atlas by Microwell-Seq. Cell, 2018.173 ( 5): p.1307.) and Seq-well (Gierahn, T.M., et al., Seq-Well: portable, low-cost RNA sequencing of single cells at high throughput. Nat Methods, 2017.14(4): p.395- 398.) platform and the common commercial platform 10×Gennomics. However, taking a microplate as an example, when the input am...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q2535/122C12Q2563/155C12Q2521/107
Inventor 郭国骥廖原陈海德韩晓平王晶晶
Owner ZHEJIANG UNIV