An ultra-high-throughput single-cell sequencing method
A single-cell sequencing and cell-based technology, applied in the field of single-cell sequencing, can solve problems such as batch effects, high sequencing costs, and difficult portability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] 1. Microplate preparation
[0056] According to the experimental scale (500,000 human 293T cells and 500,000 mouse 3T3 cells each), the size of the microwell plate (well plate size is 1.8cm×1.8cm) is designed, and the microwell is etched on the silicon wafer as the initial mold, and the microwell is a cylinder Body shape, in which the micropore depth is 60 μm, the micropore diameter is 50 μm, and the hole spacing is 70 μm. Next, polydimethylsiloxane (PDMS) was poured on the silicon wafer. After molding, the PDMS was taken out to become the second mold with micro-pillars on the plate. The microplate used in the final experiment was a concentration of 5% (mass ratio ) of agarose (prepared with enzyme-free water), poured on the PDMS micro-column plate after heat-melting and condensed to form, and the agarose plate at this time is peeled off to form a micro-well plate with a certain thickness ( figure 1 ). When storing, add DPBS-EDTA mixture, which is harmless to cells, ...
Embodiment 2
[0067] Human 293T, murine 3T3 mixed cell test.
[0068] Mouse embryonic stem cells (ESC) 3T3 and human embryonic kidney cells (293T), 5 million each, were slowly added dropwise with 5-10 ml methanol (-20 °C pre-cooling) and fixed at -20 °C for 30 minutes. At the same time, the bridging primers were distributed. Put 6.5 μl per well in an eight-coupled tube, and then dispense it into a 96-well plate containing 0.5 μl of reverse transcription primers, and let it stand and mix to form a total of 1 μl of reverse transcription mixed primers per well. The bridging primer sequence is 5'- CGTCGTGTAGGGAAAGAGTGT GACGCTGCCGACGA[ddC]-3', ddC modification at the 3' end prevents the generation of by-products caused by the extension of the bridging primer during reverse transcription.
[0069] The reverse transcription primers (reverse transcription sequences) are also 96 kinds of the above cell tag sequences, the core sequence is 6×N, each primer is placed independently in each well, this ...
Embodiment 3
[0085] cDNA sequencing library construction.
[0086] (1) 5ng initial DNA fragmentation
[0087] Use Vazyme TD512 kit.
[0088] (a) Thaw 5×TTBL (TruePrep Tagment Buffer L) at room temperature, invert and mix well before use. Confirm that 5×TS (Terminate Solution, reaction stop solution) is at room temperature, and flick the tube wall to confirm the presence or absence of precipitation. If there is precipitation, it can be dissolved by heating at 37°C and vigorously shaking to mix well.
[0089] (b) Add each reaction component in sequence to a sterilized PCR tube:
[0090] 5 x TTBL 4 μl
[0091] DNA 5ng
[0092] TTE Mix V1 5μl
[0093] ddH 2 O make up to 20 μl.
[0094] (c) Mix well by gently pipetting 20 times with a pipette.
[0095] (d) The PCR tube was placed in the PCR machine, and the following reaction program was set: 55°C for 10 min; incubation at 10°C.
[0096] (e) Immediately add 5 μl of 5×TS to the reaction product, and mix well by gently pipetting with a ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


