Salmonella detection primer group, method and kit based on RPA-LbCas12a-TTECDS system
A technology for Salmonella and detection primers, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve problems such as lack of homology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Materials and methods
[0040] 1.1 Strain screening and DNA extraction
[0041] Standard strains Salmonella typhimurium ATCC700720, Staphylococcus aureus ATCC25923, Listeria monocytogenes ATCC15313, Shigella flexneri ATCC12022, and Escherichia coli ATCC25922 were purchased from the ATCC strain bank. Cucumbers were purchased from a local supermarket. 50 strains of Salmonella clinical specimens in Changzhou were collected through the pathogen identification network. Genomic DNA of Salmonella was extracted by boiling method.
[0042] 1.2 Primer design and RPA reaction
[0043] The full-length nucleotide sequence of the invA gene:
[0044]gtgctgctttctctacttaacagtgctcgtttacgacctgaattactgattctggtactaatggtgatgatcatttctatgttcgtcattcc attacctacctatctggttgatttcctgatcgcactgaatatcgtactggcgatattggtgtttatggggtcgttctacattgacagaatcctca gtttttcaacgtttcctgcggtactgttaattaccacgctctttcgtctggcattatcgatcagtaccagtcgtcttatcttgattgaagccgatg ccggtgaaattatcgccacgttcgggcaattcgttattggcgatagcc...
Embodiment 2
[0076] The application also provides a fast, ultra-sensitive, high-precision Salmonella detection kit based on RPA-LbCas12a-TTECDS, its working principle is as follows Figure 7 shown. In order to improve the detection sensitivity, crRNA at 6 different positions was selected as the best crRNA fluorescence, and the efficiency of crRNA at different positions of the target gene was different. For rapid detection technology, getting enough fluorescence value as soon as possible is crucial for detection. Therefore, it is particularly necessary to screen crRNA, and at the same time, 7 DNA bases are added to the 3'-end of crRNA to form a chimeric DNA-RNA. This has several benefits: First, it improves target specificity by changing the binding energy between crRNA and target. Secondly, the chimeric DNA-RNA form is more convenient for product storage. Finally, the chimeric DNA-RNA form can improve the cleavage activity of high-efficiency crRNA, increase the fluorescence intensity by ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


