Method for high-throughput rapid detection of pathogenic microorganisms

A technology of pathogenic microorganisms and microorganisms, applied in biochemical equipment and methods, measurement/inspection of microorganisms, bioinformatics, etc., can solve problems such as high cost, influence of pathogenic microorganism detection methods, and inability to fully analyze microorganisms

Inactive Publication Date: 2021-08-06
JIAXING YUNYING MEDICAL INSPECTION CO LTD
View PDF15 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR-based detection of pathogenic microorganisms is susceptible to amplification bias, is more costly than culture-based detection, and has limitations in distinguishing between live and dead cells
Methods based on targeted sequencing technologies, such as 16S rRNA, 18s rRNA or ITS (ribosomal internal transcribed spacer), contain only selected partial gene fragments, are related to predetermined databases of known microorganisms, and cannot adequately analyze new microorganisms , which also has an amplification preference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high-throughput rapid detection of pathogenic microorganisms
  • Method for high-throughput rapid detection of pathogenic microorganisms
  • Method for high-throughput rapid detection of pathogenic microorganisms

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1, sample nucleic acid extraction

[0058] 1.1 Nucleic acid extraction from non-blood samples

[0059] Take an appropriate amount of samples (sputum 100ul, lavage fluid 200ul, pleural effusion 1ml, fresh punctured tissue the size of a sesame seed) and 8% formalin solution as a negative control, centrifuge at 3300rpm for 10min, discard the supernatant;

[0060] Wash the pellet with PBS buffer, repeat twice and then centrifuge to remove the supernatant;

[0061] Add 200ul of H 2 O mixed with the precipitate;

[0062] Add 50ul of propidium azide bromide with a concentration of 0.4M, shake and mix;

[0063] Avoid light at room temperature for 5 minutes;

[0064] Illumination for 25 minutes. At this stage, the sample needs to be placed on the shaker. During the illumination, pay attention to the lower layer of ice to reduce the temperature of the light;

[0065] Add 20ul of proteinase K with a concentration of 20mg / ml, add 1ul of 20% SDS solution;

[0066] F...

Embodiment 2

[0075] Embodiment 2, reverse transcription and purification

[0076] Take 10ul of the collected nucleic acid solution and add 10ul of 1st RT mix to mix, start the PCR program: 25°C, 10min; 42°C, 30min; 70°C, 15min for reverse transcription reaction;

[0077] After the reaction, add 30ul of 2st RNA mix and mix well. Reaction program: 16°C, 60min; 4°C, keep, to obtain the reverse transcription product;

[0078] Purification: Add 90ul of purified magnetic beads (beads) to the reverse transcription product for purification, mix and incubate for 5min, place on a magnetic stand, slowly aspirate and discard the supernatant, add 200ul of 80% ethanol to rinse once, and wait for 20s;

[0079] Discard the supernatant, and repeat the 80% ethanol rinse again;

[0080] After waiting for the magnetic beads to dry, add 53ul of H 2 O was eluted to obtain the purified product.

Embodiment 3

[0081] Embodiment 3, enzyme digestion method library construction

[0082] Take 50ul of the purified product, add 15ul of end repair enzyme, reaction program: 30°C, 10min; 70°C, 15min;

[0083] Add 25ul adapter ligation buffer, 5ul adapter ligase, 5ul adapter, reaction program: 20°C, 20min; 4°C, hold, to obtain the adapter ligation product;

[0084] 75ul beads purification, washed twice with 80% ethanol;

[0085] 22ul H 2 O was eluted to obtain a purified product;

[0086] Take 20ul of the purified product, add 25ul of PCR amplification enzyme, 5ul of primers (forward primer: AATGATACGGCGACCACCGAGAT, SEQ ID No: 53, reverse primer: CAAGCAGAAGACGGCATACGA, SEQ ID NO: 52), and perform 6-12 rounds of PCR.

[0087] Specific materials of end repair enzymes, adapter ligation buffer, adapter ligase, adapters, and PCR amplification enzymes used in library construction by enzyme digestion can be found in Table 1 below.

[0088] Table 1 Materials contained in the components used in li...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting pathogenic microorganisms. The method comprises the following steps: simultaneously separating and extracting DNA and RNA from a sample of a subject; performing reverse transcription on the extracted RNA to obtain cDNA; treating the extracted DNA and the extracted cDNA by using a composition containing a plurality of enzymes, so as to obtain treated DNA and treated cDNA; performing PCR amplification on the basis of the treated DNA and the treated cDNA so as to construct a sequencing library; performing metagenome sequencing on the basis of the sequencing library to obtain a metagenome sequencing result of the sample; and determining the pathogenic microorganisms in the sample based on the metagenome sequencing result, a pathogenic microorganism genome database and a species classification database. The invention also discloses a kit for establishing the microbial metagenome sequencing library. The kit comprises a fragmentation and terminal repair system, wherein the fragmentation and terminal repair system comprises DNA incision enzymes, T4 polynucleotide kinase, T4 DNA polymerase, a Klinno fragment and Taq enzymes.

Description

technical field [0001] The present application relates to the field of biotechnology, in particular to a high-throughput rapid detection method for pathogenic microorganisms and a kit for a metagenomic sequencing library. Background technique [0002] Infectious diseases infected with pathogenic microorganisms (eg, new coronavirus, influenza virus, Ebola virus, etc.) threaten people's health. The spread of pathogens and multidrug-resistant pathogens make accurate diagnosis and effective treatment of infectious diseases face increasing challenges. With the emergence of new pathogenic microorganisms, the increase of drug-resistant pathogenic microorganisms, and the increase of immunosuppressed hosts, morbidity and mortality remain high. Especially for patients with severe infection, the onset is rapid, the progression is rapid, and the pathogen is complex. It is very important to be able to identify the pathogenic microorganism in a short period of time. [0003] Although th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869C12Q1/04C40B50/06G16B20/30G16B50/00
CPCC12Q1/6869C40B50/06G16B20/30G16B50/00C12Q2531/113C12Q2535/122C12Q2537/165
Inventor张道允巩子英孙永华虞洪杰
OwnerJIAXING YUNYING MEDICAL INSPECTION CO LTD