Construction and fermentation method of artificial strain with high yield of fengycin
A high-yield strain and fermentation method technology, which is applied in the construction and fermentation field of Fengyuansu high-yield artificial strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Construction of Fengyuansu synthetic strain B.subtilis ds
[0036] (1) Design and synthesis of primers for sfp gene amplification. According to the nucleic acid sequence of the sfp gene (as shown in SEQ ID NO: 1), the amplification primers were designed as follows (the underlined straight line indicates the SalI restriction site, and the underlined wavy line indicates the BglII restriction site). Technology Co., Ltd. for synthesis.
[0037] SFP-F:AA GGCCAA CGAGGCCCAAAAAGAAGAACGGACACAGCGGTTC
[0038] SFP-R:
[0039]
[0040] (2) Extraction of the genome of Bacillus amyloliquefaciens FZB42. Take 3-5mL of bacterial liquid cultured in LB liquid medium at 37°C and 220rpm / min for 12-16h, centrifuge at 4°C and 12000rpm for 30s, and collect the precipitate. Add 500 μL of cell lysate to the precipitation, shake it upside down 7-8 times, and keep it in a 37°C metal bath for 30 minutes. Add 264 μL of 5M NaCl solution to the above lysate, shake it upside down 7-8...
Embodiment 2
[0058] Example 2: Construction of B.subtilis dspabacd, a high-yielding strain of Fengyuansu
[0059] (1) According to the nucleic acid sequence of the promoter P43 (as shown in SEQ ID NO: 3), the nucleic acid sequence of the acetyl-CoA synthetase gene acs (as shown in SEQ ID NO: 4), the acetyl-CoA carboxylase gene accACD The nucleotide sequence (as shown in SEQ ID NO: 6) and the nucleotide sequence (as shown in SEQ ID NO: 5) of the biotin ligase gene birA were entrusted to Qingke Biotechnology Co., Ltd. to synthesize acs, birA, accACD and P43 in series fusion fragment, and connected into the expression vector pHT43, the construction process is as follows Figure 5 As shown, the recombinant expression plasmid pHTABPC carrying birA gene, acs gene, accACD gene and P43 promoter was obtained.
[0060](2) The expression plasmid pHTABPC was introduced into B. subtilis ds by means of transformation, spread on a chloramphenicol screening pressure plate for solid plate culture, and cul...
Embodiment 3
[0061] Embodiment three: the cultivation and fermentation of B.subtilis ds and B.subtilis dspabacd
[0062] (1) Culture medium composition:
[0063] Seed medium: tryptone 10g / L, yeast extract powder 5g / L, NaCl 10g / L, pH 7.0;
[0064] Fermentation medium: xylose 20g / L, water-soluble soybean cake powder 21.9g / L, NaNO 3 3.1g / L, MnSO 4 ·H 2 0.2g / L, pH 7.5.
[0065] (2) Cultivation and fermentation of B. subtilis ds and B. subtilis dspabacd. The fengyuansu synthetic strain B.subtilis ds and the fengyuansu high-yielding bacterial strain B.subtilis dspabacd of the present invention were respectively cultured on solid plates, cultured upside down at 37°C for 13-17 hours, single colonies were taken, and continued to be cultured on solid plates , cultured upside down at 37°C for 24 hours, took a single colony, and carried out seed culture in 50mL liquid medium, cultivated at 37°C and 220rpm / min for 12h to obtain seed liquid, and inoculated with a volume ratio of 5% Inoculate a la...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap