Method for detecting aflatoxin B1 based on fluorescent copper nanoparticles

A nanoparticle and fluorescent copper technology, applied in the fields of materials science, nanobiosensing, and analytical chemistry, to achieve the effect of highly selective and highly sensitive fluorescence detection

Active Publication Date: 2021-08-20
JIANGNAN UNIV
View PDF11 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Food safety regulations are increasingly strict on the residue limit of AFB1 in food. Using simple fluorescent nanoprobe design to achieve high sensitivity, high selectivity, and high accuracy detection, there is no relevant research report so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting aflatoxin B1 based on fluorescent copper nanoparticles
  • Method for detecting aflatoxin B1 based on fluorescent copper nanoparticles
  • Method for detecting aflatoxin B1 based on fluorescent copper nanoparticles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] A method for preparing fluorescent copper nanoparticles β-CD@DNA-Cu NMs, comprising the steps of:

[0074] (1) Preparation of template strand Y-type complementary nucleic acid duplex (Y-type DNA):

[0075] Three equal oligonucleotide strands (Y 0a ,Y 0b ,Y 0c ) (Table 1) in MOPS buffer (10mM, pH 7.5, 150mMNaAc, 1mM MgCl 2 ) to obtain a mixed solution; then, the mixed solution was heated to 90°C, denatured for 5 minutes, and then slowly cooled to room temperature to obtain Y-shaped DNA; the Y-shaped DNA solution was stored in a -18°C refrigerator.

[0076] Table 1 DNA sequence of oligonucleotide chain

[0077] serial number sequence (from 5' to 3')) Y 0a

CCTGTCTGCCTAATGTGCGTCGTAAG SEQ ID NO.1 Y 0b

CTTACGACGCACAAGGAGATCATGAG SEQ ID NO.2 Y 0c

CTCATGATCTCCTTTAGGCAGACAGG SEQ ID NO.3

[0078] (2) Preparation of DNA-Cu NMs:

[0079] Mix Y-shaped DNA solution (500 μL, 2 μM) with ascorbic acid solution (500 μL, 1.25 mM), t...

Embodiment 2

[0083] The optimization of embodiment 2 fluorescent copper nanoparticles preparation technology

[0084] The concentration of the β-CD solution in Example 1 was adjusted to 0.5, 2, and 5 mM, and the others were kept the same as in Example 1 to obtain β-CD@DNA-Cu NMs.

[0085] The obtained β-CD@DNA-Cu NMs were subjected to a fluorescence test. The conditions of the fluorescence test were: the excitation broadband was 10nm, the slit width was 10nm, and the excitation wavelength was 365nm; the test results were as follows:

[0086] figure 2 are the TEM images of β-CD@DNA-Cu NMs modified with different concentrations of β-CD; where (a) is 0.5mM, (b) is 2mM, and (c) is 5mM. from figure 2 It can be seen that as the concentration of β-CD increases from 0.5 to 2 and 5 mM, the average size of β-CD@DNA-Cu NMs increases from 10 nm to 12 nm and 14 nm, respectively. The concentration of β-CD is in the range of 0-5mM. With the increase of its concentration, the fluorescence is stronger...

Embodiment 3

[0089] A method for preparing a ratiometric fluorescence sensor of β-CD@DNA-Cu NMs-AFB1, comprising the steps of:

[0090] Add the β-CD@DNA-Cu NMs solution (100 μL, 200 μM) obtained in Example 1 into the AFB1 solution (900 μL, 10 ppb), shake at 400 rpm for 1 min, and mix well to obtain β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor.

[0091] The obtained β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescence sensor was tested for fluorescence. The test conditions were: the excitation broadband was 10nm, the slit width was 10nm, the excitation wavelength was 365nm, the detection was 433nm (AFB1) and 650nm (β- CD@DNA-Cu NMs) fluorescence values ​​of the two emission peaks.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for detecting aflatoxin B1 based on fluorescent copper nanoparticles and belongs to the technical fields of analytical chemistry, material science and nano biosensing. The beta-CD@DNA-Cu NMs are prepared by taking Y-type DNA as a template, ascorbic acid as a reducing agent and beta-CD as a fluorescence stability enhancer; then a ratiometric fluorescent probe is constructed by using the beta-CD@DNA-Cu NMs; and finally, high-sensitivity, high-selectivity and high-accuracy AFB1 detection is realized by using a fluorescent probe. According to the method disclosed by the invention, when the linear range is 0.03-10ppb and 10-18ppb, the ratio of I433nm / I650nm and the concentration of AFB1 respectively present a good linear relationship, and the detection limit is 0.012 ppb (S / N=3); the metal ions can be changed into Yb<3+>, Y<3+>, Er<3+> and Pt<2+>, and the method is also suitable for improving the detection limit of AFB1 in rice.

Description

technical field [0001] The invention relates to a method for detecting aflatoxin B1 based on fluorescent copper nanoparticles, and belongs to the technical fields of analytical chemistry, materials science and nanobiological sensing. Background technique [0002] Aflatoxin (AFT) is one of the most common pollutants in grains. It is a kind of mycotoxin widely distributed in nature and has strong teratogenicity, carcinogenicity and physiological and metabolic toxicity. Among them, aflatoxin B1 (AFB1) is the most toxic and carcinogenic, and is classified as a class I carcinogen by the International Agency for Research on Cancer (IARC). Long-term consumption of foods containing low levels of aflatoxin will cause the liver to accumulate toxicity, causing liver damage and liver cancer, which seriously threaten human health and even life. Traditional detection methods are mainly instrumental analysis methods such as high-performance liquid chromatography (HPLC), liquid chromatogra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N21/64
CPCG01N21/6402G01N21/6486
Inventor彭池方李敏邰胜梅魏新林
OwnerJIANGNAN UNIV