Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cytochrome P450 monooxygenase CYP109B2 mutant and application thereof

A CYP109B2, monooxygenase technology, applied in the field of biocatalytic enzymes

Active Publication Date: 2021-09-14
HUBEI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The complexity of the steroidal molecular structure determines the diversity of the functionalization of the steroidal core. Nearly 20 or more hydroxylation sites have brought great challenges to the site-directed modification of steroidal compounds.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cytochrome P450 monooxygenase CYP109B2 mutant and application thereof
  • Cytochrome P450 monooxygenase CYP109B2 mutant and application thereof
  • Cytochrome P450 monooxygenase CYP109B2 mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Obtainment and Activity Verification of Cytochrome P450 Monooxygenase CYP109B2

[0034] 1. CYP109B2 gene cloning

[0035] Cultivate Sonora desert bacillus (Bacillus sonorensis) on seawater 2216 agar plate medium by conventional methods in the field, then extract the genome of Bacillus sonorensis by conventional methods in the field, and use this as a template to perform conventional PCR amplification to obtain the target Gene, the primers used are:

[0036] CYP109B2-F: ATGAACTCGGCAAAACAGCAGAAC (shown in SEQ ID NO:3)

[0037] CYP109B2-R: TCATGATGAAAGCAGCGCCTCTTTG (shown in SEQ ID NO:4)

[0038] The amplified product was detected by electrophoresis and sequenced. Its nucleotide sequence is shown in SEQ ID NO:2, and its translated amino acid sequence is shown in SEQ ID NO:1. Since this enzyme has 61.9% amino acid sequence homology with the reported CYP109 family CYP109B1, it was confirmed that the novel P450 monooxygenase is a member of the cytochrome monooxyg...

Embodiment 2

[0058] Construction of embodiment 2 CYP109B2 protease mutant library

[0059] 1. Determination of mutation sites

[0060] Using the homologous structure of CYP109B2 protein, the shape of the CYP109B2 active pocket and the binding form of the substrate testosterone to the enzyme molecular pocket were analyzed, and the molecular structure of the steroidal substrate testosterone was drawn by the scientific research drawing tool ChemBioDraw Ultra 14.0, and the protein crystal structure was used to analyze The software YASARA performed molecular dynamics simulation (MD) and molecular docking on the energy-minimized 3D molecular structure of testosterone and the obtained crystal structure of CYP109B2, and selected the molecules around the substrate testosterone The amino acid positions within the range are respectively N68, F70, V84, S85, L240, A241, T245, A288, I291, V292, F294, S387 and M388 (i.e. the 68th amino acid sequence shown in SEQ ID NO: 1 , 70, 84, 85, 240, 241, 245, 28...

Embodiment 3

[0069] Expression and enzyme activity identification of embodiment 3CYP109B2 mutant

[0070] 1. Expression of CYP109B2 mutant

[0071] The PCR product obtained from the single-point saturation mutation and degenerate primer mutation in Example 2 was digested with the restriction endonuclease Dpn I, and the PCR product was transformed into Escherichia coli BL21 using a conventional transformation method in the art and After sequencing, all 19 amino acid mutants except the wild-type amino acid at the target site were obtained, indicating that the complete library of amino acid mutants at this site was completed. Then, the mutated nucleotide sequence was expressed according to the construction method of the recombinant cell E.coli (pRSFDuet-1-CYP109B2-Fdr_0978_Fdx_1499) in Example 2 to express the CYP109B2 mutant.

[0072] 2. Determination of catalytic activity and selectivity

[0073] After using the above method to express different CYP109B2 mutants, according to the detectio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cytochrome P450 monooxygenase CYP109B2 mutant and application thereof, wherein the CYP109B2 mutant comprises at least one amino acid mutation in the 68th site, the 70th site, the 84th site, the 85th site, the 240th site, the 241th site, the 245th site, the 288th site, the 291th site, the 292th site, the 294th site, the 387th site or the 388th site of an amino acid sequence shown in SEQ ID NO: 1. According to the invention, a cytochrome P450 monooxygenase CYP109B2 capable of carrying out hydroxylation modification on the 16 beta site of a steroid compound is found from Bacillus sonorensis; on the basis, mutation is carried out on key active sites of the P450 enzyme; a mutant library is constructed; a series of mutants with significantly improved catalytic activity and / or changed selective sites are screened out; a new resource is provided for fixed-point hydroxylation modification of the steroid compound and synthesis of a steroid hydroxylation product; the catalytic efficiency is remarkably improved; and the production process is economical and environmentally friendly.

Description

technical field [0001] The invention belongs to the technical field of biological catalytic enzymes, and in particular relates to a cytochrome P450 monooxygenase CYP109B2 mutant and application thereof. Background technique [0002] Steroid (hormone) compounds are usually biologically active compounds with the basic mother nucleus skeleton of cyclopentane polyhydrophenanthrene. Steroid hormones are widely involved in metabolism and synthesis in biological organisms, and play a very important role in the regulation of biological life activities. effect. Steroids mainly include adrenocortical hormones and sex hormones, which are widely used clinically to treat diseases such as cardiovascular, rheumatism, inflammation, endocrine disorders, and antitumor. Steroids are currently the second largest class of drugs on the market after antibiotics. [0003] Chemical modification of the four rings of steroidal compounds can endow steroidal drugs with stronger physiological and pharm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/53C12N15/70C12N1/21C12P33/06C12R1/19
CPCC12N9/0081C12N15/70C12Y114/15006C12P33/06
Inventor 李爱涛张小栋李倩赵晶邓迪
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com