Production method of anti-staphylococcus aureus genetically modified goat
A genetic modification, goat technology, applied in the field of genetic engineering, can solve problems such as poor prevention effect, no breakthrough, no long-term effect, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Preparation of embodiment 1 TLR2-4 transgenic goat
[0076] 1. Preparation of TLR2-4 chimeric gene
[0077] Referring to the exon sequences of goat TLR2 and TLR4 in GenBank, two pairs of primers were designed and synthesized. The primer sequences are as follows:
[0078] TLR2 gene amplification primers:
[0079] Forward: 5'-GCCTCTGATCAGGCTTCTTC-3'
[0080] Reverse: 5'-CCTAGGACCTTATTGCAGCT-3'
[0081] TLR4 gene amplification primers:
[0082]Forward: 5'-ATCATCAGCGTGTCGGTTGT-3'
[0083] Reverse: 5'-TCAGGTGGAGGTGGTCGCTT-3'
[0084] Extract goat blood RNA, reverse transcribe and synthesize cDNA, use the above primers as a template, use the RT-PCR method to amplify goat TLR2 and TLR4 gene fragments, and use the following primers at the 5' end of the TLR2 exon A signal peptide and a Myc sequence were added, and a 20 bp TLR4 extracellular region homologous sequence was added to the 3' end of the TLR2 extracellular region exon.
[0085] Forward: ATGCCACGTGCTTTGTGGACAGCGT...
Embodiment 2
[0135] Example 2 RT-PCR Identification of Transgenic Goat TLR2-4 Chimeric Protein
[0136] RNA was extracted from peripheral blood macrophages of newborn lambs, and RT-PCR detection and WB detection were performed. The results showed that the cDNA of transgenic goat macrophages successfully amplified the TLR2-4 chimeric gene fragment. The PCR detection results are shown in Figure 5 . Primers are as follows:
[0137] Primer P1: (TLR2-4 chimeric gene amplification primer)
[0138] Forward: TGACTTCCTGTCCTTCACACA
[0139] Reverse: CTTTACCAGTTCATTCCGCA
[0140] Primer P2: (amplification primer for internal reference gene GAPDH)
[0141] Forward: CTGACCTGCCGCCTGGAGAAA
[0142] Reverse: GTAGAAGAGTGAGTGTCGCTGTT
[0143] The results showed that the site-specific integration of TLR2-4 chimeric gene and the expression of TLR2-4 chimeric protein had been successfully performed in transgenic goats.
Embodiment 3
[0144] Example 3 Identification of TLR2-4 gene-transferred goat macrophage phagocytosis ability of Staphylococcus aureus
[0145] FITC-labeled Staphylococcus aureus was used to infect TLR2-4 macrophages and goat macrophages of the WT control group at MOI=10 for 1 hour, and after washing with PBS three times, the cells were incubated with DMEM containing 200 μg / ml gentamicin for 1 hour. Remove bacteria adhering to the cell surface. The phagocytosis index (mean fluorescence intensity of FITC in macrophages) and phagocytosis rate (number of FITC-positive cells / total cytometry×100%) of cells in the two groups were detected by flow cytometry. Such as Figure 6 As shown, at 30 min, 60 min, and 120 min of infection, the phagocytic index of TLR2-4 macrophages on Staphylococcus aureus was significantly higher than that of wild-type goat macrophages in the two groups. Such as Figure 7 As shown, the phagocytosis rate of S. aureus by TLR2-4 macrophages was significantly higher than th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More