Application of miR-302b-3p as anti-tumor marker of oral squamous cell carcinoma
A technology for squamous cell carcinoma and oral cavity, which is applied in the field of tumor diagnosis and treatment, can solve the problems that miR-302b-3p and OSCC invasiveness or migration have not been reported and have not been fully confirmed, and achieve rich drug selection, Effect of delaying invasion and/or migration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 The relationship between the invasion and migration ability of OSCC cell lines and the expression level of miR-302b-3p
[0029] Using eukaryotic cell transfection technology, miR-302b-3p-mimic [sense strand: UAAGUGCUUCCAUGUUUUAGUAG (SEQ ID NO.1); antisense strand CUACUAAAACAUGGAAGCACUUA (SEQ ID NO.2)], miR-302b-3p-off [CUACUAAAAACAUGGAAGCACUUA (SEQ ID NO.3)] or random miRNA mimic [ie NC-mimic; micrON mimic NC sequence sense strand: UUUGUACUACACAAAAGUACUG (SEQ ID NO.4), antisense strand: CAGUACUUUUGUGUAGUACAAA (SEQ ID NO.5); micrOFF inhibitor NC Sequence: CAGUACUUUUGUGUAGUACAA (SEQ ID NO.6)] OSCC cell lines HSC-3, HSC-4, UM1 and UM2 were transfected respectively. Use Transwell invasion assay and migration assay to detect migration and invasion before and after transfection. In addition, cellular RNA was extracted, and the expression of miR-302b-3p was detected by qRT-PCR.
[0030] The specific operation method is as follows:
Embodiment 2
[0036] Embodiment 2 Nude mouse OSCC buccal xenograft tumor animal model metastasis experiment
[0037] The method is as follows: ① Preparation of cell suspension: a. Luciferase gene (Luciferase) labeled cells: the highly invasive HSC-3 cell line with in vitro tumorigenic ability was used to label the cells with luciferase (Luciferase) gene. The blank group is the normal untreated luciferase gene-marked HSC-3 cell line, the control group is the luciferase gene-marked HSC-3 cell line overexpressing NC mimic, and the experimental group is the fluorescent cell line overexpressing miR-302b-3p. Sulfase gene labeled HSC-3 cell line. Cultivate until the exponential growth phase with good growth status. Collect the cells and prepare a serum-free and antibiotic-free medium (DMEM) to resuspend the cell solution, count and adjust the cell concentration to 1×10 7 / mL. ②Put the Matri-gel glue in a 4-degree refrigerator to melt in advance. The above cell suspension was mixed with Matri-g...
Embodiment 3
[0040] Embodiment 3 verification target gene
[0041] According to software prediction, it was found that FZD6 is the target gene of miR-302b-3p, and its target recognition mode is as follows: image 3 As shown in A. The purpose of this example is to verify whether the gene is the target gene.
[0042] 1. Validation of dual luciferase reporter gene system
[0043] Method: HEK-293T cells were seeded in a 96-well plate, so that the density of transfected cells reached 1×10 7 / mL. The miR-302b-3p overexpression vector and psiCHECK-2-Report-FZD6-3'UTR vector were co-transfected into 293T cells, and the miR-302b-3p overexpression vector and psiCHECK-2-Report-FZD6- 3'UTR mut vector or psiCHECK-2-Report empty vector was used as control. Each group was co-transfected with jellyfish luciferase (PRL-TK) as an internal reference, and the transfection reagent was invitrogenlipofectamine 2000. After 48 hours of transfection, the green fluorescent light was observed under a fluorescen...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com