Unlock instant, AI-driven research and patent intelligence for your innovation.

Engineered ribokinase as well as coding gene, expression vector, engineering bacterium and application thereof

A ribokinase, encoding gene technology, applied in the field of biopharmaceuticals and biotransformation, can solve the problems of high price of 5-phosphate ribose, no further research, etc., and achieve the effect of good catalytic activity and improved yield

Pending Publication Date: 2021-11-09
杭州灵犀健康科技有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, Shangke Biology (CN108949865A) discloses a method for immobilized cells to catalyze the reaction of 5-phosphate ribose and nicotinamide to generate NMN. The immobilized cells can be reused, and the reaction concentration can reach 13.3g / L. However, 5-phosphate Ribose is more expensive
Bangtai Biology (US2018162895A1) disclosed a three-enzyme cascade method of ribokinase, pyrophosphate synthase and nicotinamide phosphoribosyltransferase to synthesize NMN, and molecularly modified the nicotinamide phosphoribosyltransferase to obtain a better The first step of the cascade reaction (ribokinase-catalyzed generation of 5-phosphate ribose) was not further studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineered ribokinase as well as coding gene, expression vector, engineering bacterium and application thereof
  • Engineered ribokinase as well as coding gene, expression vector, engineering bacterium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: the construction of gene cloning and expression vector

[0027] The amino acid sequence of the wild-type ribokinase derived from Escherichia coli can be retrieved from NCBI, as shown in Sequence 1, and then the corresponding nucleic acid was synthesized by common techniques in the art and cloned into the expression vector pet28a. Transform the recombinant expression plasmid into competent cells of E.coil BL21(DE3), the transformation condition is 42°C, heat shock for 90 seconds, the transformation solution is spread on the LB plate containing chloramphenicol, and cultured upside down at 37°C overnight, that is Recombinant transformants were obtained.

Embodiment 2

[0028] Example 2: Expression of ribokinase and preparation of enzyme solution

[0029] Transfer 5 μL of the frozen RK bacterial solution into 5 mL (containing 50 μL / ml kanamycin sulfate) LB medium, and activate overnight.

[0030] The activated bacterial liquid was put into 500mL LB medium, cultured at 37°C until the OD600 was about 0.7, and pre-cooled to 20°C.

[0031] Add the IPTG inducer with a final concentration of 0.2 mM, and then put it into a shaker at 20° C. for 20 h.

[0032] The cultured bacterial liquid was centrifuged and washed three times with pH 8.0, 50mM Tris-His buffer (containing 100mM NaCl)

[0033] The washed bacteria were resuspended with pH 8.0, 50 mM Tris-His buffer (containing 100 mM NaCl), and ultrasonically lysed. The lysed broken bacteria solution was taken out and centrifuged, and the supernatant was taken for subsequent reactions.

Embodiment 3

[0034] Example 3: Construction of ribokinase mutant library

[0035] According to the crystal structure of ribokinase, the key amino acids (14, 16, 42, 46, 143, 265, 273) around the active center were selected and mutated into alanine (A), a typical representative of small-medium-large volume, respectively. Leucine (L), Phenylalanine (F). The specific method is as follows:

[0036] The PCR system is: 5 μL of 10xBuffer, 5 μL of 2mM dNTPs, 1 μL of plasmid DNA template (50ng / μL), 2 μL of upstream and downstream primers (10 μM), 0.5 μL of high-fidelity enzyme, 1 μL of DMSO, and 34 μL of ddH2O. The codons of the PCR primers at the mutation positions are as follows:

[0037] Mutant Primer sequence N14A CTGGGTAGCGTTGCGGCAGATCATGTTC N14L CTGGGTAGCGTTCTGTGCAGATCATGTTC N14F CTGGGTAGCGTTTTTGCAGATCATGTTC D16A GTTAATGCAGCGCATGTTCTG D16L GTTAATGCACTGCATGTTCTG D16F GTTAATGCATTTCATGTTCTG G42A GTTATTCCGGGTGCGAAAGGCGCAAATC G42L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular-modified engineered ribokinase as well as a coding gene, expression vector, engineering bacterium and application thereof. An optimal mutant strain (G42F) is screened by adopting a rational-designed directed evolution technology. A preparation method comprises the following steps: taking pet28a as a vector, mutating 42-site glycine into phenylalanine by utilizing a site-directed mutagenesis technology, and carrying out culturing and expressing in escherichia coli. Compared with a wild type ribokinase, the engineered ribokinase provided by the invention has higher reaction activity.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals and biotransformation, and specifically relates to an engineered ribokinase and its application. Background technique [0002] Nicotinamide mononucleotide (NMN) participates in the synthesis of an important coenzyme nicotinamide adenine dinucleotide (NAD) in human cells, and plays an important role in cellular energy production. In recent years, NMN has received widespread attention due to its application in anti-aging and age-related degenerative diseases, and its preparation method has also become a research hotspot for major pharmaceutical companies. From the perspective of catalysts, the synthesis of NMN is mainly divided into chemical catalysis and biocatalysis, among which biocatalysis has the advantages of environmental protection, high efficiency and less by-products. [0003] A number of companies have also reported methods for the biocatalytic synthesis of NMN. For example, Shangke Bi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/70C12N1/21C12P19/02C12R1/19
CPCC12N9/1205C12N15/70C12P19/02C12Y207/01015
Inventor 李桂东王剑峰
Owner 杭州灵犀健康科技有限公司