Primer and probe for detecting delta 69/70 HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe
A technology of deletion mutation and virus, applied in the field of biomedicine, can solve the problems of high cost and long time consumption, and achieve the effect of high specificity and sensitive signal
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0028] Example 1. Primers and probes of new crown virus Alpha strain S gene A69 / 70HV missing mutant site
[0029] Due to the lack of amino acids 69 and 70 in the new coronavirus Alpha strain S gene, the ALPHA strain RT-QPCR method is carried out if the primer and probe designed based on the original strain s gene of the new crown virus may not be detected. New crown Alpha strain. The genome defective genotype is determined to be a reliable mark of an Alpha strain. The Alpha strain S gene Δ69 / 70HV lack sites designed primers and probes can be used as one of the effective proof of determining the Alpha strain.
[0030] Table 1. Primers used in the present invention, probe sequence
[0031] Sequence name Sequence information (5'-3 ') SEQ.ID.NO Alpha strain S gene forward primer CTTGGTTCCATGCTATCTCTCCTC 1 Alpha strain S gene reverse primer AttatgttagActorTcTcAgtggg 2 Original strain S gene forward primer Cttgtaatgtgtgaaggtg 3 Original strain S gene...
Example Embodiment
[0033] Example 2. Novel Coronary Virus Alpha strain S gene Δ69 / 70HV deletion mutant site detection
[0034] First, detect the required reagent
[0035] 1) Reagent I (1 ml / tube): Fluorescence quantitative PCR reaction buffer.
[0036] 2) Reagent II (lyophilized): At the same time, an Alpha strain and a primitive strain primer were added, the mixture of the probe (the primer concentration was 0.2 μmol / L, the concentration of the probe was 0.2 μmol / L).
[0037] 3) Reagents III: Premix EX TAQTM enzyme mixture (TAKARA).
[0038] 4) Yang - nature controls: The synthesis of new coronavirus Alpha strain S gene purpose fragments and fragments including new coronavirin primer strains.
[0039] 5) Yin properties control: water treated with diethyl pyrophosphate.
[0040] 6) Specimen type: nasal swab, throat swab, alveolar lavage.
[0041] Second, nucleic acid extraction
[0042]The commercial RNA extraction kit is used, such as a silica gel film centrifugal method or a magnetic bead ...
Example Embodiment
[0055] Example 3. Specific detection of primers and probes
[0056] The RNA fragment containing new crown virus Alpha strain, new crown virus raw toxic strain, SARS, and MERS coronavirus, respectively, according to the steps in Example 2, respectively. figure 1 with figure 2 As shown, the results show that the new crown virus Alpha strain is added, and the reaction tube of the new crown virus raw strain has occurred in FAM and HEX fluorescence paths, respectively. In the reaction tube of the RNA fragment of SARS and MERS coronavirus, the RNA fragment of the MERS coronavirus, whether it is FAM, or the HEX channel CT value is greater than 30 (displayed is negative), indicating the design of new crown virus Alpha strain, new crown virus raw toxicity Plant primers and fluorescent probes have high reaction specificity.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2023 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap