Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nannochloropsis oculata genetic transformation system, gene for synthesizing triglyceride and application

A technology of triglyceride and Nannochloropsis, applied in the directions of application, genetic engineering, plant genetic improvement, etc., can solve problems such as no relevant reports to prove, and achieve the effects of shortening growth time, improving transformation efficiency, and increasing content

Pending Publication Date: 2021-11-16
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To sum up, it is necessary and feasible to use the genetic transformation system of Nannochloropsis to transform its DGAT and increase the TAG content of cells, but there are no relevant reports to prove whether it can be achieved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nannochloropsis oculata genetic transformation system, gene for synthesizing triglyceride and application
  • Nannochloropsis oculata genetic transformation system, gene for synthesizing triglyceride and application
  • Nannochloropsis oculata genetic transformation system, gene for synthesizing triglyceride and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1: Construction of Nannochloropsis universal expression vector

[0051] Design two primers, introduce the required enzyme cutting sites at both ends of the primers, and submit them to Shanghai Sangong for synthesis:

[0052] Primer 1)

[0053] 5'TATGGCATGCGTCGACCCGCGGACGCGTGCTAGCGGCGCCAAGCTTCTGCAGCCCGGGGGATCCCATCATCACCATCACCATCACCATTAAG3';

[0054] Primer 2)

[0055] 5'TTAAGAATTACCACTACCACTACCACTACTACCCTAGGGGGCCCGACGTCTTCGAACCGCGGCGATCGTGCGCAGGCGCCCAGCTGCGTACGGT 3'.

[0056] Using the annealing combination of the above two primers, a DNA fragment with a length of 86bp with cohesive ends (containing NdeI and EcoRI restriction sites at both ends) was obtained, and the fragment contained a total of 8 effective restriction sites ( figure 1 ) and a tag encoding 8 consecutive histidines (for subsequent expression detection). The fragment was directional cloned into vector pXJ004 (Wang et al, 2016) using NdeI and EcoRI restriction sites, and the vector was named...

Embodiment 2

[0059] (1) Cloning of NoDGAT2B gene

[0060] The NoDGAT2B gene and its flanking sequences were cloned from the gDNA and cDNA of Nannochloropsis IMET1 by PCR technology. The primers used were designed by ourselves, and the required enzyme cutting sites were introduced at both ends of the primers, which were synthesized by Shanghai Sangong. The primers were specific for:

[0061] 1) NoDGAT2B-for:

[0062] 5'GGTACCACATAATGACGCAGGTC 3';

[0063] 2) NoDGAT2B-rev:

[0064] 5'GAATTCTCACTTAATAAGCAGCTTCTTG 3'.

[0065] The PCR instrument used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL of dNTP (2.5 mM each, TAKARA), 2 μL of forward and reverse primers (10 μM), 5 μL of 10×buffer (Mg2 + plus, TAKARA), 0.4 μL of rTaq enzyme (5 U / μL, TAKARA), 1 μL of wild-type IMET1 cDNA template (50 ng / μL), and 35.6 μL of ultrapure water. The reaction system is as follows: initial denaturation at 94°C for 3 min, then denaturation at 94°C for 30 sec, annealin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology. The invention relates to a gene for synthesizing triglyceride (TAG), an efficient and stable genetic transformation system and application of the gene in increasing the content of the triglyceride. The gene for synthesizing triglyceride (TAG) has a base sequence as shown in SEQ ID NO 1; or 2) a DNA sequence which has more than 95% of homology with the nucleic acid sequence limited by the sequence 1 in the sequence table and is used for coding the same biological function protein. The general expression vector is as follows: 1) a base sequence as shown in SEQ ID NO 2; or 2) a DNA sequence which has more than 90% of homology with the nucleic acid sequence limited by the sequence 2 in the sequence table and has the same function with the nucleic acid sequence limited by the sequence 2 in the sequence table. And an optimized transformation method is provided, so that the established genetic transformation system has a huge application prospect for industrial microalgae character improvement by utilizing genetic engineering.

Description

technical field [0001] The invention belongs to the field of biotechnology. The invention relates to a gene for synthesizing triglyceride (TAG), a highly efficient and stable genetic transformation system and its application in increasing the content of triglyceride. Background technique [0002] Eukaryotic microalgae are regarded as "cell factories" for the production of sugars, lipids and biologically active substances due to their fast growth, high photosynthetic efficiency, and strong environmental adaptability (Hu et al., 2008). In addition, some eukaryotic microalgae such as Chlorella and Nannochloropsis can be cultivated outdoors on a large scale, which has great potential for industrialization (Wijffels et al., 2010). In recent years, the vigorous development of systems biology based on various omics data has created a new era of microalgae synthetic biology. In the field of microalgae synthetic biology, the design and transformation of a specific algae species (st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/10C12N15/11C12N15/79C12N1/13C12R1/89
CPCC12N9/1029C12Y203/0102C12N15/79
Inventor 辛一王勤涛徐健
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com