Nannochloropsis oculata genetic transformation system, gene for synthesizing triglyceride and application
A technology of triglyceride and Nannochloropsis, applied in the directions of application, genetic engineering, plant genetic improvement, etc., can solve problems such as no relevant reports to prove, and achieve the effects of shortening growth time, improving transformation efficiency, and increasing content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Embodiment 1: Construction of Nannochloropsis universal expression vector
[0051] Design two primers, introduce the required enzyme cutting sites at both ends of the primers, and submit them to Shanghai Sangong for synthesis:
[0052] Primer 1)
[0053] 5'TATGGCATGCGTCGACCCGCGGACGCGTGCTAGCGGCGCCAAGCTTCTGCAGCCCGGGGGATCCCATCATCACCATCACCATCACCATTAAG3';
[0054] Primer 2)
[0055] 5'TTAAGAATTACCACTACCACTACCACTACTACCCTAGGGGGCCCGACGTCTTCGAACCGCGGCGATCGTGCGCAGGCGCCCAGCTGCGTACGGT 3'.
[0056] Using the annealing combination of the above two primers, a DNA fragment with a length of 86bp with cohesive ends (containing NdeI and EcoRI restriction sites at both ends) was obtained, and the fragment contained a total of 8 effective restriction sites ( figure 1 ) and a tag encoding 8 consecutive histidines (for subsequent expression detection). The fragment was directional cloned into vector pXJ004 (Wang et al, 2016) using NdeI and EcoRI restriction sites, and the vector was named...
Embodiment 2
[0059] (1) Cloning of NoDGAT2B gene
[0060] The NoDGAT2B gene and its flanking sequences were cloned from the gDNA and cDNA of Nannochloropsis IMET1 by PCR technology. The primers used were designed by ourselves, and the required enzyme cutting sites were introduced at both ends of the primers, which were synthesized by Shanghai Sangong. The primers were specific for:
[0061] 1) NoDGAT2B-for:
[0062] 5'GGTACCACATAATGACGCAGGTC 3';
[0063] 2) NoDGAT2B-rev:
[0064] 5'GAATTCTCACTTAATAAGCAGCTTCTTG 3'.
[0065] The PCR instrument used was MasterCycler from Eppendorf Company, the reaction system was 50 μL, including 4 μL of dNTP (2.5 mM each, TAKARA), 2 μL of forward and reverse primers (10 μM), 5 μL of 10×buffer (Mg2 + plus, TAKARA), 0.4 μL of rTaq enzyme (5 U / μL, TAKARA), 1 μL of wild-type IMET1 cDNA template (50 ng / μL), and 35.6 μL of ultrapure water. The reaction system is as follows: initial denaturation at 94°C for 3 min, then denaturation at 94°C for 30 sec, annealin...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com