Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant escherichia coli for producing pentamethylene diamine and application of recombinant escherichia coli

A technology for recombining Escherichia coli and producing pentamethylene diamine, which is applied in the application, recombinant DNA technology, bacteria and other directions, can solve the problems of increasing environmental pollution, limited production, and reducing the economy of product atoms, and achieves good expression of heterologous genes, Gentle effect of cellular catalytic reaction process

Active Publication Date: 2021-12-21
NANJING UNIV OF TECH
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, in the current path of L-lysine fermentation to produce 1,5-pentanediamine, the yield of 1,5-pentanediamine is limited and the yield is low. 2 Not only greatly reduces the atomic economy of the product, but also increases the pollution to the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli for producing pentamethylene diamine and application of recombinant escherichia coli
  • Recombinant escherichia coli for producing pentamethylene diamine and application of recombinant escherichia coli
  • Recombinant escherichia coli for producing pentamethylene diamine and application of recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Construction of pTrc99a-cadA-cbbM recombinant plasmid

[0032] Synthetic lysine decarboxylase gene cadA, the nucleotide coding sequence is shown in SEQ NO.1:

[0033]ATGAACGTTATTGCAATATTGAATCACATGGGGGTTTATTTTAAAGAAGAACCCATCCGTGAACTTCATCGCGCGCTTGAACGTCTGAACTTCCAGATTGTTTACCCGAACGACCGTGACGACTTATTAAAACTGATCGAAAACAATGCGCGTCTGTGCGGCGTTATTTTTGACTGGGATAAATATAATCTCGAGCTGTGCGAAGAAATTAGCAAAATGAACGAGAACCTGCCGTTGTACGCGTTCGCTAATACGTATTCCACTCTCGATGTAAGCCTGAATGACCTGCGTTTACAGATTAGCTTCTTTGAATATGCGCTGGGTGCTGCTGAAGATATTGCTAATAAGATCAAGCAGACCACTGACGAATATATCAACACTATTCTGCCTCCGCTGACTAAAGCACTGTTTAAATATGTTCGTGAAGGTAAATATACTTTCTGTACTCCTGGTCACATGGGCGGTACTGCATTCCAGAAAAGCCCGGTAGGTAGCCTGTTCTATGATTTCTTTGGTCCGAATACCATGAAATCTGATATTTCCATTTCAGTATCTGAACTGGGTTCTCTGCTGGATCACAGTGGTCCACACAAAGAAGCAGAACAGTATATCGCTCGCGTCTTTAACGCAGACCGCAGCTACATGGTGACCAACGGTACTTCCACTGCGAACAAAATTGTTGGTATGTACTCTGCTCCGGCAGGCAGCACCATTCTGATTGACCGTAACTGCCACAAATCGCTGACCCACCTGATGATGATGAGCGATGTTACGCCAATCTATTTCCGCCCGACCCGTAACGCTTACGGT...

Embodiment 2

[0049] Example 2 Construction of pCWJ-prkA-GroEL / GroES recombinant plasmid

[0050] The phosphoribosinase gene prkA of spinach was checked by NCBI and sent to Qingke Biological Company for synthesis. The sequence is shown in SEQNO. 3:

[0051] atggcagtttgtaccgtttatacgattccgaccaccacccatctgggcagcagctttaatcagaataacaaacaggttttttttaactataaacgtagcagcagcagcaacaacaccctgtttaccacccgcccgagctatgttattacctgtagccagcagcagaccattgttatcggtctggccgcagattctggttgtggtaaaagcacctttatgcgtcgtctgacctccgtttttggcggcgcagcagaaccgccgaaaggcggtaatccggatagcaacaccctgattagcgataccaccaccgttatttgtctggatgattttcattcactggatcgtaacggtcgtaaagtagaaaaagttaccgcactggatcctaaagccaatgattttgatctgatgtatgaacaggttaaagccctgaaagaaggtaaagcagtggataaaccgatttataatcatgttagcggtctgctggatccgccggaactgatccagccgccgaaaattctggttattgaaggtctgcatccgatgtatgatgcacgtgtgcgtgaactgctggatttttctatctatctggatattagcaacgaagttaaatttgcctggaaaattcagcgtgatatgaaagaacgtggtcattccctggaaagcattaaagcaagtattgaaagccgtaaaccggattttgatgcatatattgatccacagaaacagcatgcagatgtggttattgaagt...

Embodiment 3

[0067] Example 3 Construction and Induced Expression of Recombinant Escherichia coli KACCPG

[0068] 1. Construction of recombinant Escherichia coli KACCPG

[0069] The recombinant plasmids pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL / GroES were transformed into high-lysine-producing Escherichia coli KA30 and cultured overnight for 24 h. plate growth chart see figure 1 .

[0070] This bacterial strain presents a round transparent colony with smooth edges on a solid plate added with sodium pyruvate, and the bacterial strain has higher requirements for nutrients, so the plate colonies are smaller.

[0071] Inoculate the positive strain into 5 ml LB / Amp+CmR liquid medium, the liquid medium consists of peptone 10 g / L, yeast powder 5 g / L, sodium chloride 5 g / L, at 37 °C, 200 rpm Incubate overnight with shaking. When OD 600 From 0.6 to 0.8, 800 μL of 30% glycerol + 800 μL of bacterial solution was used to preserve the strain at -80 °C.

[0072] 2. Induced expression of recombinant E...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant escherichia coli for producing pentamethylene diamine and application of the recombinant escherichia coli. A ribulose diphosphate carboxylase gene in rhodospirillum, a ribose phosphate kinase gene and a lysine decarboxylase gene in spinach are synthesized from the beginning, PCR copy an escherichia coli molecular chaperone gene to construct a plasmid pTrc99a-cadA-cbbM and a plasmid pCWJ-prkA-GroEL / GroES, the double-plasmid recombinant bacteria grow well in a specific culture medium, and glucose is efficiently utilized. According to the recombinant escherichia coli, inducers arabinose and IPTG are respectively added in different time periods, the heterologous gene expression is stable, the reaction system is simple, the condition is mild, the period is short, few byproducts are produced, the method is clean and pollution-free, the method is a simple, rapid and efficient production way, and the fermentation result shows that the yield of the recombinant escherichia coli KACCPG is obviously improved.

Description

technical field [0001] The invention belongs to the field of preparation of pentamethylenediamine, and in particular relates to a recombinant Escherichia coli producing pentamethylenediamine and an application thereof. Background technique [0002] The bacteria of the genus Corynebacterium and Escherichia that have the ability to produce L-lysine are transformed by DNA recombination technology, and industrial production has now been realized. Lysine decarboxylase can remove a carboxyl group from L-lysine to generate 1,5-pentanediamine and CO 2 . For example, in E. coli, 1,5-pentanediamine is biosynthesized directly from L-lysine by two lysine decarboxylase polypeptides CadA and LdcC. As an important chemical intermediate, 1,5-pentanediamine is used to prepare a variety of new materials and polymers, and has high application value in industrial production. [0003] However, in the current path of L-lysine fermentation to produce 1,5-pentanediamine, the yield of 1,5-pentane...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66C12N15/64C12N15/60C12N15/54C12N15/31C12N1/21C12P13/00C12R1/19
CPCC12N15/70C12N15/52C12N9/88C12N9/1205C07K14/245C12P13/001C12Y401/01018C12Y401/01039C12Y207/01018Y02A50/30
Inventor 王昕廖杨陈可泉王静朱强强王静雯徐双欧阳平凯
Owner NANJING UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More