Recombinant escherichia coli for producing pentamethylene diamine and application of recombinant escherichia coli
A technology for recombining Escherichia coli and producing pentamethylene diamine, which is applied in the application, recombinant DNA technology, bacteria and other directions, can solve the problems of increasing environmental pollution, limited production, and reducing the economy of product atoms, and achieves good expression of heterologous genes, Gentle effect of cellular catalytic reaction process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Construction of pTrc99a-cadA-cbbM recombinant plasmid
[0032] Synthetic lysine decarboxylase gene cadA, the nucleotide coding sequence is shown in SEQ NO.1:
[0033]ATGAACGTTATTGCAATATTGAATCACATGGGGGTTTATTTTAAAGAAGAACCCATCCGTGAACTTCATCGCGCGCTTGAACGTCTGAACTTCCAGATTGTTTACCCGAACGACCGTGACGACTTATTAAAACTGATCGAAAACAATGCGCGTCTGTGCGGCGTTATTTTTGACTGGGATAAATATAATCTCGAGCTGTGCGAAGAAATTAGCAAAATGAACGAGAACCTGCCGTTGTACGCGTTCGCTAATACGTATTCCACTCTCGATGTAAGCCTGAATGACCTGCGTTTACAGATTAGCTTCTTTGAATATGCGCTGGGTGCTGCTGAAGATATTGCTAATAAGATCAAGCAGACCACTGACGAATATATCAACACTATTCTGCCTCCGCTGACTAAAGCACTGTTTAAATATGTTCGTGAAGGTAAATATACTTTCTGTACTCCTGGTCACATGGGCGGTACTGCATTCCAGAAAAGCCCGGTAGGTAGCCTGTTCTATGATTTCTTTGGTCCGAATACCATGAAATCTGATATTTCCATTTCAGTATCTGAACTGGGTTCTCTGCTGGATCACAGTGGTCCACACAAAGAAGCAGAACAGTATATCGCTCGCGTCTTTAACGCAGACCGCAGCTACATGGTGACCAACGGTACTTCCACTGCGAACAAAATTGTTGGTATGTACTCTGCTCCGGCAGGCAGCACCATTCTGATTGACCGTAACTGCCACAAATCGCTGACCCACCTGATGATGATGAGCGATGTTACGCCAATCTATTTCCGCCCGACCCGTAACGCTTACGGT...
Embodiment 2
[0049] Example 2 Construction of pCWJ-prkA-GroEL / GroES recombinant plasmid
[0050] The phosphoribosinase gene prkA of spinach was checked by NCBI and sent to Qingke Biological Company for synthesis. The sequence is shown in SEQNO. 3:
[0051] atggcagtttgtaccgtttatacgattccgaccaccacccatctgggcagcagctttaatcagaataacaaacaggttttttttaactataaacgtagcagcagcagcaacaacaccctgtttaccacccgcccgagctatgttattacctgtagccagcagcagaccattgttatcggtctggccgcagattctggttgtggtaaaagcacctttatgcgtcgtctgacctccgtttttggcggcgcagcagaaccgccgaaaggcggtaatccggatagcaacaccctgattagcgataccaccaccgttatttgtctggatgattttcattcactggatcgtaacggtcgtaaagtagaaaaagttaccgcactggatcctaaagccaatgattttgatctgatgtatgaacaggttaaagccctgaaagaaggtaaagcagtggataaaccgatttataatcatgttagcggtctgctggatccgccggaactgatccagccgccgaaaattctggttattgaaggtctgcatccgatgtatgatgcacgtgtgcgtgaactgctggatttttctatctatctggatattagcaacgaagttaaatttgcctggaaaattcagcgtgatatgaaagaacgtggtcattccctggaaagcattaaagcaagtattgaaagccgtaaaccggattttgatgcatatattgatccacagaaacagcatgcagatgtggttattgaagt...
Embodiment 3
[0067] Example 3 Construction and Induced Expression of Recombinant Escherichia coli KACCPG
[0068] 1. Construction of recombinant Escherichia coli KACCPG
[0069] The recombinant plasmids pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL / GroES were transformed into high-lysine-producing Escherichia coli KA30 and cultured overnight for 24 h. plate growth chart see figure 1 .
[0070] This bacterial strain presents a round transparent colony with smooth edges on a solid plate added with sodium pyruvate, and the bacterial strain has higher requirements for nutrients, so the plate colonies are smaller.
[0071] Inoculate the positive strain into 5 ml LB / Amp+CmR liquid medium, the liquid medium consists of peptone 10 g / L, yeast powder 5 g / L, sodium chloride 5 g / L, at 37 °C, 200 rpm Incubate overnight with shaking. When OD 600 From 0.6 to 0.8, 800 μL of 30% glycerol + 800 μL of bacterial solution was used to preserve the strain at -80 °C.
[0072] 2. Induced expression of recombinant E...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com